Genetics Commons^™

Does Junk Dna Regulate Gene Expression In Humans, M. A. Hulten, Michael W. Stacey, S. J. Armstrong

Bioelectrics Publications

No abstract provided.

The Development Of Scars For Identification Of Am Fungi, Jason Daniel Abbas

Dissertations and Theses @ UNI

We have developed a rapid method of identification using molecular techniques to detect and differentiate two isolates of arbuscular mycorrhizal (AM) fungi. Polymerase Chain Reaction (PCR) was used to produce DNA fragments unique to the genomes of Glomus mosseae and Gigaspora margarita through RAPD analysis. The banding patterns produced by the arbitrary 10 base primer (5' CTGCCGCCAC) resulted in isolate specific fragments which were cloned using the pCR II™ cloning vector (lnvitrogen) and subsequently sequenced. Sequence data of the fragments led to the design of specific primer pairs (5' CTGCCGCCACTGGAACATGATTTTG and 5' CTGCCGCCACCAGAAATCGAACCG for Gigaspora margarita , 5' CTGCCGCCACCCCTATTTTAATCTAGCand5'CTGCCGCCACTGTCGGAATA for …

Localisation Of The Gene For A Novel Form Of Charcot-Marie-Tooth Disease In An Isolated Population, Kaite Honeyman

Theses : Honours

Localising the gene for a previously undescribed autosomal recessive form of CMT involved the use of a relatively new approach to rapid genome screening based on the identification of segments which are inherited identical by descent (IBD) from common founding ancestors. It is most feasible for populations which have been founded relatively recently (say less than 25 generations) and which have remained relatively isolated either geographically or culturally. The method is not suitable for highly inbred populations, that is with first and second cousin matings, as many segments will be inherited by chance. It appears to be a suitable screening …

Shark Bay World Heritage Area Draft Management Plan For Fish Resources, Fisheries Department Of Western Australia

Fisheries Management Papers

Shark Bay was inscribed on the World Heritage List in December 1991 on the basis of its natural values. The Department of Conservation and Land Management (CALM) is the management agency with responsibility for the oversight and development of management plans dealing with both the marine and terrestrial aspects of the World Heritage Area. This Draft plan deals with the management of fish resources in the Shark Bay World Heritage Area which are the responsibility of the Fisheries Department of Western Australia.

Rock Lobster Industry Advisory Commitee Chairman's Report, October 1994 - The Western Rock Lobster Fishery - Management Proposals For The 1994/95 And 1995/96 Seasons, Rock Lobster Industry Advisory Committee, Peter Rogers

Fisheries Management Papers

The failures of past restrictions on fishing effort to fully halt the decline of the breeding stock led to the formation of a sub-committee of the Rock Lobster Industry Advisory Committee. The prime objective of the sub-committee is to evaluate effective long term strategies for managing the fishery so that breeding stock is maintained at an adequate level despite the inevitable increases in catching efficiency. The purpose of this report is firstly to advise industry of the management proposals for the 1994/95 seasons and secondly to form a basis for industry consultation on management arrangements for the 1995/96 season.

Long Term Management Strategies For The Western Rock Lobster Fishery (4 Volumes) - Law Enforcement Considerations (Volume 4), Neil Mclaughlan

Fisheries Management Papers

This report has been prepared for the consideration of the RLIAC Sub Committee in consultation with members of the Sub Committee working group on law enforcement and with senior staff of the Operations Division of the Fisheries Department. It is focussed exclusively on law enforcement issues associated with the management options for the West Australian west coast rock lobster fishery which were under consideration by the Sub Committee at the time of report preparation and should be read in conjunction with Fisheries Management Paper No. 67 entitled "Evaluation of management options" which covers the broader industry management issues. This report …

Long Term Management Strategies For The Western Rock Lobster Fishery (4 Volumes) - A Market-Based Economic Assessment For The Western Rock Lobster Industry (May 1994) (Volume 3), Marec Pty Ltd

Fisheries Management Papers

In October 1992 a special Sub-Committee of the Rock Lobster Industry Advisory Committee was set up to consider and evaluate future management strategies for the rock lobster fishery. Pursuant to this the Director of Fisheries commissioned a marketing study that is the basis of this report. This study was commenced in early October 1993 and completed in May 1994. This study looked at the market implications of fishery's management strategies. In particular it assesses how the existing management structure limits the potential for the lobster industry to maximise the financial return, and in doing so provides an insight into the …

Long Term Management Strategies For The Western Rock Lobster Industry (4 Volumes) - Economic Efficiency Of Alternative Input And Output Based Management Systems In The Western Rock Lobster Fishery (Volume 2), Bob Lindner

Fisheries Management Papers

Since 1965, the Western Rock Lobster Fishery has been managed by what is essentially a license limitation scheme invoiving restricted entry for boats, and strict controls on the aggregate number of pots which can be used by the commercial fishing sector. By most measures, management of this fishery has been highly successful. Biological over-exploitation of the fish stock has been prevented, at least until recently. Notwithstanding these achievements, there is widespread concern that the future profitability, and even the viability of the industry is under threat unless the current management practices are reformed. Because of the complexity and intrinsic uncertainty …

Long Term Management Strategies For The Western Rock Lobster (4 Volumes) - Evaluation Of Management Options (Volume 1), B. K. Bowen, Rock Lobster Industry Advisory Committee

Fisheries Management Papers

This report has been written following approval by the Minister for Fisheries of a recommendation by the Rock LObster Industry Advisory Committee that a major evaluation of future management options for the western rock lobster fishery be undertaken. The report provides background information on the management strategies and principles of the fishery, its stock status, the use of input and output controls and the size of the fishing fleet. The report concludes with an examination of the effect of maintaining effort (input) controls and moving to a system of variable effort (TAE/ITEs) or moving to direct (output) controls on the …

Future Of Management Of Recreational Gill, Haul, And Cast Netting In Western Australia And Summary Of Submissions To The Netting Review, F. B. Prokop, L. M. Adams

Fisheries Management Papers

The results of a major review into recreational gill and haul netting in Western Australia were announced by the Minister for Fisheries, Hon. Monty House MLA on 24 December 1993. This document presents the findings of the recreational netting review and the process which resulted in the announced changed to management practices.

A Thyroid Hormone-Regulated Gene In Xenopus Laevis Encodes A Type Iii Iodothyronine 5-Deiodinase., Donald L. St Germain, Robert Schwartzman, Walburga Croteau, Akira Kanamori, Zhou Wang, Donald D. Brown, Valerie Galton

Dartmouth Scholarship

The type III iodothyronine 5-deiodinase metabolizes thyroxine and 3,5,3'-triiodothyronine to inactive metabolites by catalyzing the removal of iodine from the inner ring. The enzyme is expressed in a tissue-specific pattern during particular stages of development in amphibia, birds, and mammals. Recently, a PCR-based subtractive hybridization technique has been used to isolate cDNAs prepared from Xenopus laevis tadpole tail mRNA that represent genes upregulated by thyroid hormone during metamorphosis. Sequence analysis of one of these cDNAs (XL-15) revealed regions of homology to the mRNA encoding the rat type I (outer ring) 5'-deiodinase, including a conserved UGA codon that encodes selenocysteine in …

Analysis Of Human Sperm Chromatin Integrity, Silvina M. Bocca

Theses and Dissertations in Biomedical Sciences

Determining potential maternal or paternal sources of abnormal chromosomal constitution gives opportunity for preconception genetic counseling. The most direct determination is achieved by analyzing the nuclear constitution of the gametes.

The present study evaluated the integrity of human spermatozoal nuclear material in the two condensation stages of chromatin and chromosomes. Original semen samples (ORI) and their swim-up fractions (SW, selected for motility) from men of known (donors) and unknown (patients) fertility were analyzed. The extent of chromatin condensation was assessed by light microscopy and flow cytometry during the time course of a chemically-induced decondensation reaction.

Motile spermatozoa were used to …

Localisation And Detection Of A Polymorphism In The Human Skeletal Beta-Tropomyosin Gene (Tpm2), Clive C.J. Hunt

Theses : Honours

Tropomyosin is one of the components of the thin filaments of muscle, binding to actin, and, together with troponin, regulating contraction in a calcium-dependent manner (Cho et al.,1990). There are at least four distinct tropomyosin genes in vertebrates and each may encode at least six different isoforms of tropomyosin by alternate splicing (Novy et al, 1993; MacLeod et al., 1988). The alpha-tropomyosin gene TPM1 has recently been localised to 15q22 (Eyre et al, 1994) and has been shown to be mutated in some cases of familial hypertrophic cardiomyopathy (Thierfelder et al., 1994). The alpha-tropomyosin gene TPM3 has been recently localised …

Development And Application Of A Thermistor Current Meter, Carl M. Way, Albert J. Burky, Christine Miller-Way

Biology Faculty Publications

This report provides details for the construction of a hot-bead thermistor current meter which is capable of measuring water velocities on a millimeter spatial scale and for the construction of a compact and accurate calibration system. Hot-bead thermistor current meters can be built with response times of 200 ms capable of measuring velocities between 0.1 and 80 cm s-1. The construction of a sturdy probe for application in lotic systems such as high gradient Hawaiian streams was achieved by the use of heavy-duty acrylic tubing, small stainless steel gas-chromatography tubing, and flexible Tygon spaghetti tubing. An acrylic handle anchors the …

Cytogenetic Analysis And Development Of Fish (Fluorescent In Stu Hybridisation) Techniques To Delineate Deletions Of Chromosome 22 In Di George Syndrome And Related Disorders, Marie Mccluskey

Theses : Honours

This honours project is based on the advancement of in situ hybridisation to metaphase chromosome spreads. The technique was carried out using cosmid probes which are specific for microdeleted regions on chromosome 22q11 associated with Di George syndrome (DGS) and related disorders. Disorders similar to DGS include partial Di George syndrome, III-IV pharyngeal pouch syndrome, velucardiofacial syndrome (VCFS), conotruncal facial anomaly and the CHARGE association. Recently the group of disorders with this microdeletion and comparable symptoms has been summarised by the acronym CATCh 22. Large deletions, translocations, monosomies, and trisomies of chromosomes are apparent under the light microscope, when prepared …

An Analysis Of Mitochondrial Dna In Rett Syndrome And Other Neurodegenerative Disorders, Catherine Erickson Burgess

Theses and Dissertations in Biomedical Sciences

Mitochondrial dysfunction resulting from mutations on mitochondrial DNA (mtDNA) is being recognized in a growing spectrum of diseases. These diseases, resulting from single base mutations, large deletions, or insertions, have been largely neuromuscular in origin. However, as an understanding of the effects of mtDNA mutations progresses, attention is now focusing on neurodegenerative diseases. Rett Syndrome (RS), a progressive neurodegenerative disease with predominantly female cases, demonstrates morphologic mitochondrial changes, mitochondrial enzyme deficiencies and maternal inheritance (characteristic of mtDNA diseases). No investigation of mtDNA involvement has been previously conducted and, to date, no biological marker exists for this disorder.

Our preliminary studies …

Characterization Of Male Sterility And Polyploidy In Watermelon, Brent Alan Murdock

All Dissertations

No abstract provided.

Approximation Methods For Singular Diffusions Arising In Genetics, Nacer E. Abrouk

Mathematical Sciences Technical Reports (MSTR)

Stochastic models in population genetics leading to diffusion equations are considered. When the drift and the square of the diffusion coefficients are polynomials, an infinite system of ordinary differential equations for the moments of the diffusion process can be derived using the Martingale property. An example is provided to show how the classical Fokker-Planck Equation approach may not be appropriate for this derivation. A Gauss-Galerkin method for approximating the laws of the diffusion, originally proposed by Dawson (1980), is examined. In the few special cases for which exact solutions are known, comparison shows that the method is accurate and the …

The Introduction And Translocation Of Fish, Crustaceans And Molluscs In Western Australia., Craig Lawrence

Fisheries Management Papers

This paper discusses three possible impacts of introduced and translocated aquatic organisms: 1. Genetic diversity 2. Pathogens 3 Ecosystem Conservation, in relation to costs and benefits to the community and the Western Australian environment.

Estimation Of The Incidence Of A Rare Genetic Disease Through A Two-Tier Mutation Survey, R Chakraborty, M R Srinivasan, S Raskin

Faculty, Staff and Student Publications

Recent attempts to detect mutations involving single base changes or small deletions that are specific to genetic diseases provide an opportunity to develop a two-tier mutation-screening program through which incidence of rare genetic disorders and gene carriers may be precisely estimated. A two-tier survey consists of mutation screening in a sample of patients with specific genetic disorders and in a second sample of newborns from the same population in which mutation frequency is evaluated. We provide the statistical basis for evaluating the incidence of affected and gene carriers in such two-tier mutation-screening surveys, from which the precision of the estimates …

Artificial Insemination Of Ewes With Frozen Semen, David Windsor

Journal of the Department of Agriculture, Western Australia, Series 4

The judicious use of artificial insemination (Al) of ewes with frozen semen by ram breeders offers substantial gains for wool producers, but it promises even greater benefits if it can be used more widely within commercial breeding flocks.

In the Western Australian dairy industry, for example, genetic gains between 1971 and /986 are estimated to have been three times as great in herds bred by Al as in herds that were mated naturally.

Sheep And Wool Industries Need To Improve Their Performance, Rob Kelly, Tim Marshall

Journal of the Department of Agriculture, Western Australia, Series 4

Today in Western Australia, sheep are run at slightly higher stocking rates, are achieving greater lambing percentages (up JO per cent) and higher wool cuts per animal ( up 0. 6 kg greasy) than in the 1960s. When all components of production are considered, the productivity of sheep fanns has increased by 2. 7 per cent per year over the past 35 years.

The challenge of the next decade is to achieve substantially greater rates of improvement than for past years if the sheep and wool industries are to maintain their significant place in Western Australian agriculture.

A Family Showing No Evidence Of Linkage Between The Ataxia Telangiectasia Gene And Chromosome, D. Hernandez, C. M. Mcconville, Michael W. Stacy, C. G. Woods, M. M. Brown, P. Shutt, G. Rysiecki, A. M. R. Taylor

Bioelectrics Publications

We have studied an inbred family in which two cousins presented with the same clinical features of ataxia telangiectasia (AT). Both patients are still ambulatory at ages 25 and 20. Cellular features of both patients are typical of AT and include increased radiosensitivity and an increased level of spontaneously occurring chromosome aberrations in peripheral blood lymphocytes. Linkage studies and haplotype analysis show no clear evidence that the gene for AT in this family is on chromosome 11q22-23. As previously reported AT families from complementation groups AB, C, and D have all shown linkage to this region of 11q22-23. Our study …

Sjögren-Larsson Syndrome: Genetic Studies And Biochemical Characterization Of Human Fatty Aldehyde Dehydrogenase, Todd L. Kelson

Theses and Dissertations

Sjögren-Larsson syndrome (SLS) is an autosomal recessive disorder due to deficiency of the fatty aldehyde dehydrogenase (FALDH) component of fatty alcohol:NAD⁺ oxidoreductase (FAO). We investigated the enzymatic defect in SLS in order to elucidate the role of FALDH in fatty aldehyde and fatty alcohol metabolism.

Genetic studies were performed to investigate carrier detection for SLS. Cultured skin fibroblasts from normal controls, SLS obligate heterozygotes, and SLS homozygotes were assayed for FAO and FALDH activities using 18-carbon substrates. In SLS homozygotes, mean FAO and FALDH activities were 8% of normal, and there was no overlap between the homozygote and heterozygote …

Model Consent Forms For Dna Linkage Analysis And Storage, Roger B. Dworkin, R. L. Gold, R. R. Lebel, E. A. Mearns, T Hadro, J. K. Burns

Articles by Maurer Faculty

No abstract provided.

Detection Of Point Mutations In The Dystrophin Gene, John Pedretti

Theses : Honours

The dystrophin gene has been localised to Xp 21.1. Mutations of this gene can lead to the clinical manifestations of Duchenne and Becker muscular dystrophies (DMD/BMD). In the majority of DMD and BMD patients the disease-causing mutation is a deletion detectable by southern analysis or multiplex PCR, however in 30% of patients no deletion is observed using these conventional tests. Using PCR amplification of cDNA it was possible to detect a deletion in the product of the dystrophin gene of one such individual affected with BMD. It was then necessary to characterise the mutation in order to determine whether this …

Saccharomyces Cerevisiae Sec59 Cells Are Deficient In Dolichol Kinase Activity, Loree Heller, Peter Orlean, W. Lee Adair Jr.

Bioelectrics Publications

The temperature-sensitive Saccharomyces cerevisiae mutant sec59 accumulates inactive and incompletely glycosylated protein precursors in its endoplasmic reticulum at the restrictive temperature. O-mannosylation and glycosyl phosphatidylinositol membrane anchoring of protein are also abolished, consistent with a deficiency in dolichyl phosphate mannose. Membranes prepared from sec59 cells that had been shifted to the restrictive temperature, however, made normal amounts of dolichyl phosphate mannose when exogenous dolichyl phosphate was supplied, but dolichyl phosphate mannose synthesis was severely depressed in the absence of exogenous dolichyl phosphate. Quantitative measurements of dolichyl phosphate in sec59 cells showed that the levels were decreased to 48% of wild …

Genetics And Applications Of Nisin Production In Lactococcus Lactis Subsp. Lactis And Conjugal Exchange Of This Trait, Jeffery R. Broadbent

All Graduate Theses and Dissertations, Spring 1920 to Summer 2023

Chapter I reviews current literature on gene transfer systems in lactic acid bacteria, how genetically altered microorganisms for food are presently regulated, and how nisin is used as a food preservative.

Chapter II investigates previous reports which linked genes for nisin biosynthesis and sucrose utilization (Nip⁺Suc⁺) to plasmid DNA in two well characterized L. lactis subsp. lactis strains. Plasmid curing studies, conjugations, and DNA-DNA hybridizations indicated that these genes were encoded by chromosomal loci in all Nip⁺Suc⁺ strains examined. Similar results were noted in nisin-sucrose transconjugants of L. lactis subsp. cremoris and S. …

Biochemical Systematics Of Notothenioid Fishes From Antarctica, Mara A. Mcdonald, Michael H. Smith, Michael W. Smith, James M. Novak, Paul E. Johns, Arthur L. Devries

Faculty Research & Creative Activity

Genetic variation at 30 protein-coding loci was examined in seven forms of notothenioid fishes from Antarctica. Multilocus heterozygosity varied from 0.018 to 0.078 across taxa. An analysis of the allozyme data revealed the probable existence of an unrecognized cryptic species within Trematomu5 bemacchii. Pagothenia borchgrevinki is as closely related to some species of Trematomus as are some species of Trematomus to each other. Speciation among the species of Trematomus and Pagothenia appears to have taken place primarily after the separation of Antarctica from Australia.

Embryo Transfer In Sheep, Andras Szell

Journal of the Department of Agriculture, Western Australia, Series 4

The application of artificial breeding in the sheep industry has increased substantially over the past decade.

This article outlines the potential uses and benefits of embry transfer in sheep and describes the procedures involved.