Genetics and Genomics Commons^™

Report On Future Management Options For The South West Trawl Limited Entry Fishery, South West Trawl Limited Entry Fishery Working Group

Fisheries Management Papers

As a result of community concern regarding trawling, the current management rules for the South West Trawl Limited Entry Fishery were finalised in February 1989 and the final plan was gazetted in October of that year. However, there was public disquiet about this trawling, and as a result of this disquiet, a research program was initiated by the Fisheries Department with funding received from both the Commonwealth and State Governments. The scientific report, "The impact of trawling for saucer scallops and western king prawns on the benthic communities in coastal waters off south-western Australia" by L J B Laurenson, P …

3 Genes Of The Map Kinase Cascade, Mek-2, Mpk-1/Sur-1 And Let-60 Ras, Are Required For Meiotic Cell-Cycle Progression In Caenorhabditis-Elegans, Diane L. Church, Kun Liang Guan, Eric J. Lambie

Dartmouth Scholarship

In the germline of Caenorhabditis elegans hermaphrodites, meiotic cell cycle progression occurs in spatially restricted regions. Immediately after leaving the distal mitotic region, germ cells enter meiosis and thereafter remain in the pachytene stage of first meiotic prophase for an extended period. At the dorsoventral gonadal flexure, germ cells exit pachytene and subsequently become arrested in diakinesis. We have found that exit from pachytene is dependent on the function of three members of the MAP kinase signaling cascade. One of these genes, mek-2, is a newly identified C. elegans MEK (MAP kinase kinase). The other two genes, mpk-1/sur-1 (MAP kinase) …

The Bag And Size Limit Review: New Regulations And Summary Of Submissions, F. B. Prokop, J M. Collins

Fisheries Management Papers

Since the new bag and size limits were introduced in December 1991, there have been many suggestions for refinement and improvement of these regulations. This paper includes the summary of submissions to Fisheries Management Paper No 52 - Review of Bag and Size Limit Proposals for Western Australian Recreational Fishers and details new regulations which will come into force on 1 July 1995.

The Best Available Information - Its Implications For Recreational Fisheries Management, F. B. Prokop

Fisheries Management Papers

Workshop at Second National Fisheries Managers Conference, Bribie Island, Queensland, October 18, 1994. Recreational fisheries management is one of the growth areas in Australian fisheries. The Australian Society for Fish Biology Workshop topic for its 1994 Conference was Recreational Fishing - What's the Catch. It was acknowledged at the ASFB conference that there were generally poor levels of information and for the lower value commercial and recreational fisheries there may be no way to gather definitive research data for the foreseeable future. However, in even the high profile fisheries, public perceptions, attitudes, and political will do not allow for the …

Pathogenicity Of Murine Cytomegalovirus Mutants, Victoria Jean Cavanaugh

Theses and Dissertations in Biomedical Sciences

The purpose of this study was to identified nonessential murine cytomegalovirus (MCMV) genes involved in pathogenesis in vivo. Our approach to identifyjng these genes consisted of constructing MCMV mutants, and then analyzing these mutants in vitro and in vivo. Recombinant viruses (RV) expressing the β-glucuronidase marker gene were constructed by site-directed insertion and deletion mutagenesis of the MCMV Hind III-J and -I regions of the viral genome. Mutations were targeted to this region of the MCMV genome because the corresponding region of the human CMV genome is nonessential and is involved in down-regulating major histocompatibility complex (MHC) class I expression …

Identification And Characterization Of Genes Associated With V-Jun Induced Cell Transformation, Martin Toralballa Hadman

Biological Sciences Theses & Dissertations

The v-jun oncogene was initially identified as the causative agent for fibrosarcomas in chickens. Studies show that overexpression of v-Jun proteins transforms chicken embryo fibroblasts (CEF) in vitro, and forms tumors in chickens in vivo. The mechanisms for this are not clearly defined. Conceivably, overexpression of an unregulated transcription factor would cause cell transfonnation by illicit regulation of its target genes. In support of this, we show that in vivo v-Jun complexes exhibit differential binding to in vitro generated AP-1 and 'AP-1 like' target sequences, suggesting that the pattern of target gene expression is altered during cell transformation. …

Draft Report Of The South Coast Estuarine Fishery Working Group, South Coast Estuarine Fishery Workng Group

Fisheries Management Papers

The South Coast Estuarine Working Group was established in 1991 at the request of commercial fishermen by the Minister of the day. This report outlines a draft management plan for the South Coast Estuarine fishery that was made available for public comment.

Analyzing Correlations Of Three Types In Selected Lines Of Drosophila Melanogaster That Have Evolved Stable Extreme Geotactic Performance, Scott F. Stoltenberg, Jerry Hirsch, Stewart H. Berlocher

Department of Psychology: Faculty Publications

The behavior-genetic analysis of Drosophila melanogaster with geotactic performance as the phenotype is an ideal model system with which to investigate the complex relations between heredity and behavior. As part of a long-term, 38-year study, we report 4 experiments that identify and analyze trait correlations in the selected high- and low-geotaxis lines. We performed F₂ correlational analyses and backcrosses to examine 3 types of correlations: (a) genotype-genotype (alcohol dehydrogenase [Adh]-amylase [Amy]), (b) genotype-phenotype (Adh and Amy-geotaxis), and (c) phenotype-phenotype (mate preference–geotaxis). Only the Adh-geotaxis correlation survived meiosis and reappeared in the F …

Enhancer Trap Technique: A Novel Tool For Identification And Developmental Characterization Of Genes Of Drosophila, Amit Singh

Biology Faculty Publications

The classical technique of mutational screen for identification of genes controlling early development has now approached saturation. A new era in genetic identification and developmental characterization of genes in Drosophila has commenced with the advent of the enhancer trap technique. This technique involves mobilization of a P-lacZ vector to diverse chromosomal locations in the fruit fly genome to bring it under the regulation of developmentally expressed genes or their enhancer elements. The technique offers a strikingly elegant method of gaining entry into fruit fly genes.

Implications Of Native Title Legislation For Fisheries Management And The Fishing Industry In Western Australia, Patricia Summerfield

Fisheries Management Papers

This paper seeks to examine the key issues of both State and Commonwealth native title legislation for the fishing industry and fisheries management in Western Australia. Considerations for Aboriginal involvement in the industry and long-standing as well as recent concessionary arrangements for traditional usage of fish resources are examined. Industry reactions and future plans to accommodate native title in a positive framework are explored.

An Improved Method For Chemical Devitellinization Of X-Gal Stained Drosophila Embryos, Amit Singh, Madhuri Kango-Singh, P. Sinha

Biology Faculty Publications

In Drosophila developmental biological studies, X-gal staining is commonly employed to study the spatio-temporal expression of the lacZ reporter gene in the transformed flies or their embryos. Study of the lacZ pattern in embryos often suffers from the lack of an efficient and high yieldirrg technique for devitellinization of X-gal stained embryos. Devitellinization techniques employed during antibody staining, in situ hybridization or embryonic cuticular preparations generally do not give satisfactory results when used for similar purpose in X-gal stained embryos. This results in the flaky appearance of the blue stain. We present here an improved chemical devitellinization technique which gives …

Breeding Sheep For Worm Resistance, John Karlsson, Johan Greeff, Julia Harris

Journal of the Department of Agriculture, Western Australia, Series 4

Sheep production os one of Western Australia's most important agricultural industries. However, it is faced with the serious threat of sheep worm populations becoming increasingly resistant to the available drenches.

Although it's not a 'quick fix' solution, part of the long term answer may be selection for sheep with greater resistance to worms.

Genetic Discrimination And Health Insurance: An Urgent Need For Reform, Kathy L. Hudson, Karen H. Rothenberg, Lori B. Andrews, Mary Jo Ellis Kahn, Francis S. Collins

Faculty Scholarship

No abstract provided.

Does Junk Dna Regulate Gene Expression In Humans, M. A. Hulten, Michael W. Stacey, S. J. Armstrong

Bioelectrics Publications

No abstract provided.

The Development Of Scars For Identification Of Am Fungi, Jason Daniel Abbas

Dissertations and Theses @ UNI

We have developed a rapid method of identification using molecular techniques to detect and differentiate two isolates of arbuscular mycorrhizal (AM) fungi. Polymerase Chain Reaction (PCR) was used to produce DNA fragments unique to the genomes of Glomus mosseae and Gigaspora margarita through RAPD analysis. The banding patterns produced by the arbitrary 10 base primer (5' CTGCCGCCAC) resulted in isolate specific fragments which were cloned using the pCR II™ cloning vector (lnvitrogen) and subsequently sequenced. Sequence data of the fragments led to the design of specific primer pairs (5' CTGCCGCCACTGGAACATGATTTTG and 5' CTGCCGCCACCAGAAATCGAACCG for Gigaspora margarita , 5' CTGCCGCCACCCCTATTTTAATCTAGCand5'CTGCCGCCACTGTCGGAATA for …

Localisation Of The Gene For A Novel Form Of Charcot-Marie-Tooth Disease In An Isolated Population, Kaite Honeyman

Theses : Honours

Localising the gene for a previously undescribed autosomal recessive form of CMT involved the use of a relatively new approach to rapid genome screening based on the identification of segments which are inherited identical by descent (IBD) from common founding ancestors. It is most feasible for populations which have been founded relatively recently (say less than 25 generations) and which have remained relatively isolated either geographically or culturally. The method is not suitable for highly inbred populations, that is with first and second cousin matings, as many segments will be inherited by chance. It appears to be a suitable screening …

Shark Bay World Heritage Area Draft Management Plan For Fish Resources, Fisheries Department Of Western Australia

Fisheries Management Papers

Shark Bay was inscribed on the World Heritage List in December 1991 on the basis of its natural values. The Department of Conservation and Land Management (CALM) is the management agency with responsibility for the oversight and development of management plans dealing with both the marine and terrestrial aspects of the World Heritage Area. This Draft plan deals with the management of fish resources in the Shark Bay World Heritage Area which are the responsibility of the Fisheries Department of Western Australia.

Rock Lobster Industry Advisory Commitee Chairman's Report, October 1994 - The Western Rock Lobster Fishery - Management Proposals For The 1994/95 And 1995/96 Seasons, Rock Lobster Industry Advisory Committee, Peter Rogers

Fisheries Management Papers

The failures of past restrictions on fishing effort to fully halt the decline of the breeding stock led to the formation of a sub-committee of the Rock Lobster Industry Advisory Committee. The prime objective of the sub-committee is to evaluate effective long term strategies for managing the fishery so that breeding stock is maintained at an adequate level despite the inevitable increases in catching efficiency. The purpose of this report is firstly to advise industry of the management proposals for the 1994/95 seasons and secondly to form a basis for industry consultation on management arrangements for the 1995/96 season.

Long Term Management Strategies For The Western Rock Lobster Fishery (4 Volumes) - Law Enforcement Considerations (Volume 4), Neil Mclaughlan

Fisheries Management Papers

This report has been prepared for the consideration of the RLIAC Sub Committee in consultation with members of the Sub Committee working group on law enforcement and with senior staff of the Operations Division of the Fisheries Department. It is focussed exclusively on law enforcement issues associated with the management options for the West Australian west coast rock lobster fishery which were under consideration by the Sub Committee at the time of report preparation and should be read in conjunction with Fisheries Management Paper No. 67 entitled "Evaluation of management options" which covers the broader industry management issues. This report …

Long Term Management Strategies For The Western Rock Lobster Fishery (4 Volumes) - A Market-Based Economic Assessment For The Western Rock Lobster Industry (May 1994) (Volume 3), Marec Pty Ltd

Fisheries Management Papers

In October 1992 a special Sub-Committee of the Rock Lobster Industry Advisory Committee was set up to consider and evaluate future management strategies for the rock lobster fishery. Pursuant to this the Director of Fisheries commissioned a marketing study that is the basis of this report. This study was commenced in early October 1993 and completed in May 1994. This study looked at the market implications of fishery's management strategies. In particular it assesses how the existing management structure limits the potential for the lobster industry to maximise the financial return, and in doing so provides an insight into the …

Long Term Management Strategies For The Western Rock Lobster Industry (4 Volumes) - Economic Efficiency Of Alternative Input And Output Based Management Systems In The Western Rock Lobster Fishery (Volume 2), Bob Lindner

Fisheries Management Papers

Since 1965, the Western Rock Lobster Fishery has been managed by what is essentially a license limitation scheme invoiving restricted entry for boats, and strict controls on the aggregate number of pots which can be used by the commercial fishing sector. By most measures, management of this fishery has been highly successful. Biological over-exploitation of the fish stock has been prevented, at least until recently. Notwithstanding these achievements, there is widespread concern that the future profitability, and even the viability of the industry is under threat unless the current management practices are reformed. Because of the complexity and intrinsic uncertainty …

Long Term Management Strategies For The Western Rock Lobster (4 Volumes) - Evaluation Of Management Options (Volume 1), B. K. Bowen, Rock Lobster Industry Advisory Committee

Fisheries Management Papers

This report has been written following approval by the Minister for Fisheries of a recommendation by the Rock LObster Industry Advisory Committee that a major evaluation of future management options for the western rock lobster fishery be undertaken. The report provides background information on the management strategies and principles of the fishery, its stock status, the use of input and output controls and the size of the fishing fleet. The report concludes with an examination of the effect of maintaining effort (input) controls and moving to a system of variable effort (TAE/ITEs) or moving to direct (output) controls on the …

Future Of Management Of Recreational Gill, Haul, And Cast Netting In Western Australia And Summary Of Submissions To The Netting Review, F. B. Prokop, L. M. Adams

Fisheries Management Papers

The results of a major review into recreational gill and haul netting in Western Australia were announced by the Minister for Fisheries, Hon. Monty House MLA on 24 December 1993. This document presents the findings of the recreational netting review and the process which resulted in the announced changed to management practices.

A Thyroid Hormone-Regulated Gene In Xenopus Laevis Encodes A Type Iii Iodothyronine 5-Deiodinase., Donald L. St Germain, Robert Schwartzman, Walburga Croteau, Akira Kanamori, Zhou Wang, Donald D. Brown, Valerie Galton

Dartmouth Scholarship

The type III iodothyronine 5-deiodinase metabolizes thyroxine and 3,5,3'-triiodothyronine to inactive metabolites by catalyzing the removal of iodine from the inner ring. The enzyme is expressed in a tissue-specific pattern during particular stages of development in amphibia, birds, and mammals. Recently, a PCR-based subtractive hybridization technique has been used to isolate cDNAs prepared from Xenopus laevis tadpole tail mRNA that represent genes upregulated by thyroid hormone during metamorphosis. Sequence analysis of one of these cDNAs (XL-15) revealed regions of homology to the mRNA encoding the rat type I (outer ring) 5'-deiodinase, including a conserved UGA codon that encodes selenocysteine in …

Analysis Of Human Sperm Chromatin Integrity, Silvina M. Bocca

Theses and Dissertations in Biomedical Sciences

Determining potential maternal or paternal sources of abnormal chromosomal constitution gives opportunity for preconception genetic counseling. The most direct determination is achieved by analyzing the nuclear constitution of the gametes.

The present study evaluated the integrity of human spermatozoal nuclear material in the two condensation stages of chromatin and chromosomes. Original semen samples (ORI) and their swim-up fractions (SW, selected for motility) from men of known (donors) and unknown (patients) fertility were analyzed. The extent of chromatin condensation was assessed by light microscopy and flow cytometry during the time course of a chemically-induced decondensation reaction.

Motile spermatozoa were used to …

Localisation And Detection Of A Polymorphism In The Human Skeletal Beta-Tropomyosin Gene (Tpm2), Clive C.J. Hunt

Theses : Honours

Tropomyosin is one of the components of the thin filaments of muscle, binding to actin, and, together with troponin, regulating contraction in a calcium-dependent manner (Cho et al.,1990). There are at least four distinct tropomyosin genes in vertebrates and each may encode at least six different isoforms of tropomyosin by alternate splicing (Novy et al, 1993; MacLeod et al., 1988). The alpha-tropomyosin gene TPM1 has recently been localised to 15q22 (Eyre et al, 1994) and has been shown to be mutated in some cases of familial hypertrophic cardiomyopathy (Thierfelder et al., 1994). The alpha-tropomyosin gene TPM3 has been recently localised …

Development And Application Of A Thermistor Current Meter, Carl M. Way, Albert J. Burky, Christine Miller-Way

Biology Faculty Publications

This report provides details for the construction of a hot-bead thermistor current meter which is capable of measuring water velocities on a millimeter spatial scale and for the construction of a compact and accurate calibration system. Hot-bead thermistor current meters can be built with response times of 200 ms capable of measuring velocities between 0.1 and 80 cm s-1. The construction of a sturdy probe for application in lotic systems such as high gradient Hawaiian streams was achieved by the use of heavy-duty acrylic tubing, small stainless steel gas-chromatography tubing, and flexible Tygon spaghetti tubing. An acrylic handle anchors the …

Cytogenetic Analysis And Development Of Fish (Fluorescent In Stu Hybridisation) Techniques To Delineate Deletions Of Chromosome 22 In Di George Syndrome And Related Disorders, Marie Mccluskey

Theses : Honours

This honours project is based on the advancement of in situ hybridisation to metaphase chromosome spreads. The technique was carried out using cosmid probes which are specific for microdeleted regions on chromosome 22q11 associated with Di George syndrome (DGS) and related disorders. Disorders similar to DGS include partial Di George syndrome, III-IV pharyngeal pouch syndrome, velucardiofacial syndrome (VCFS), conotruncal facial anomaly and the CHARGE association. Recently the group of disorders with this microdeletion and comparable symptoms has been summarised by the acronym CATCh 22. Large deletions, translocations, monosomies, and trisomies of chromosomes are apparent under the light microscope, when prepared …

An Analysis Of Mitochondrial Dna In Rett Syndrome And Other Neurodegenerative Disorders, Catherine Erickson Burgess

Theses and Dissertations in Biomedical Sciences

Mitochondrial dysfunction resulting from mutations on mitochondrial DNA (mtDNA) is being recognized in a growing spectrum of diseases. These diseases, resulting from single base mutations, large deletions, or insertions, have been largely neuromuscular in origin. However, as an understanding of the effects of mtDNA mutations progresses, attention is now focusing on neurodegenerative diseases. Rett Syndrome (RS), a progressive neurodegenerative disease with predominantly female cases, demonstrates morphologic mitochondrial changes, mitochondrial enzyme deficiencies and maternal inheritance (characteristic of mtDNA diseases). No investigation of mtDNA involvement has been previously conducted and, to date, no biological marker exists for this disorder.

Our preliminary studies …

Characterization Of Male Sterility And Polyploidy In Watermelon, Brent Alan Murdock

All Dissertations

No abstract provided.