Genetics and Genomics Commons^™

Use Of Sulfometuron In Hybrid Popular Energy Plantations, Daniel A. Netzer

Aspen Bibliography

No abstract provided.

Biomass Of Food Available To Beavers On Five Minnesota Shrubs, Richard R. Buech, David J. Rugg

Aspen Bibliography

No abstract provided.

Does Junk Dna Regulate Gene Expression In Humans, M. A. Hulten, Michael W. Stacey, S. J. Armstrong

Bioelectrics Publications

No abstract provided.

The Development Of Scars For Identification Of Am Fungi, Jason Daniel Abbas

Dissertations and Theses @ UNI

We have developed a rapid method of identification using molecular techniques to detect and differentiate two isolates of arbuscular mycorrhizal (AM) fungi. Polymerase Chain Reaction (PCR) was used to produce DNA fragments unique to the genomes of Glomus mosseae and Gigaspora margarita through RAPD analysis. The banding patterns produced by the arbitrary 10 base primer (5' CTGCCGCCAC) resulted in isolate specific fragments which were cloned using the pCR II™ cloning vector (lnvitrogen) and subsequently sequenced. Sequence data of the fragments led to the design of specific primer pairs (5' CTGCCGCCACTGGAACATGATTTTG and 5' CTGCCGCCACCAGAAATCGAACCG for Gigaspora margarita , 5' CTGCCGCCACCCCTATTTTAATCTAGCand5'CTGCCGCCACTGTCGGAATA for …

Mapping The Transcriptional Start Site(S) Of The Cannabinoid Receptor Gene, Jordana Baden

MUSC Theses and Dissertations

The cannabinoid receptor gene has recently been cloned. Comparisons of cDNA clones with genomic DNA show that the gene consists of a coding region and at least two untranslated 5' exons (A and B). Two alternative transcripts, differing in their 5' untranslated sequence, have been found that code for identical receptors. Primer extension for transcript A reveal that its most 5' transcriptional start site corresponds to nucleotide -548. Additional transcripts initiated 3' of -548 may exist. Ribonuclease protection assay and primer extension for transcript B reveal that its most 5' transcriptional start site corresponds to nucleotide -406. It is possible …

Localisation Of The Gene For A Novel Form Of Charcot-Marie-Tooth Disease In An Isolated Population, Kaite Honeyman

Theses : Honours

Localising the gene for a previously undescribed autosomal recessive form of CMT involved the use of a relatively new approach to rapid genome screening based on the identification of segments which are inherited identical by descent (IBD) from common founding ancestors. It is most feasible for populations which have been founded relatively recently (say less than 25 generations) and which have remained relatively isolated either geographically or culturally. The method is not suitable for highly inbred populations, that is with first and second cousin matings, as many segments will be inherited by chance. It appears to be a suitable screening …

Molecular Cloning And Rare Cleavage Mapping Of Human 2p, 6q, 8q, 12q, And 18q Telomeres, Roberto A. Macina, Ken Morii, Xue-Lan Hu, Dimitri G. Negorev, Chrysanthe Spais, Lisa A. Ruthig, Harold C. Riethman

School of Medical Diagnostics & Translational Sciences Publications

Large terminal fragments of human chromosomes 2p, 6q, 8q, 12q, and 18q were cloned using yeast artificial chromosomes (YACs). RecA-assisted restriction endonuclease (RARE) cleavage analysis of genomic DNA samples from 11 unrelated individuals using YAC-derived probes confirmed the telomeric localizations of the half-YACs studied. The cloned Fragments provide telomeric closure of maps for the respective chromosome arms and will supply the reagents needed for analyzing and sequencing these distal subtelomeric regions.

Transcriptional Regulation Of Insulin-Like Growth Factor : Binding Protein-4 By Protein Kinase A And Protein Kinase C Signal Transduction Pathways In Human Bone Cells, Kuk-Wha Lee

Loma Linda University Electronic Theses, Dissertations & Projects

The Insulin-like Growth Factor (IGF) system is an important local regulator of osteoblast proliferation, the primary determinant of bone formation. Six IGF Binding Proteins (IGFBPs) either inhibit or enhance IGF actions. Previous studies have shown that IGFBP-4 is an important negative regulator of osteoblast cell proliferation and that agents such as PTH which increase intracellular cAMP significantly increase expression of IGFBP-4 at the protein and mRNA levels. The underlying molecular mechanism which accounted for IGFBP-4 expression had not been determined and was the focus of my dissertation. Agents which increase intracellular cAMP rapidly increased IGFBP-4 mRNA levels. Nuclear run-off experiments …

Shark Bay World Heritage Area Draft Management Plan For Fish Resources, Fisheries Department Of Western Australia

Fisheries Management Papers

Shark Bay was inscribed on the World Heritage List in December 1991 on the basis of its natural values. The Department of Conservation and Land Management (CALM) is the management agency with responsibility for the oversight and development of management plans dealing with both the marine and terrestrial aspects of the World Heritage Area. This Draft plan deals with the management of fish resources in the Shark Bay World Heritage Area which are the responsibility of the Fisheries Department of Western Australia.

A Study Of Euplotes Crassus Telomere Proteins And Related Genes, John Scott Perez

Department of Chemistry: Dissertations, Theses, and Student Research

A novel PCR technique used to amplify Euplotes crassus macronuclear chromosomes was developed to provide scientific proof that an Euplotes crassus 1.0 kb gene is not genetically related to an Oxytricha nova 1.8 kb β-telomere protein gene. Theories and experimental procedures associated with the development of this PCR technique were the product of research that will have a profound impact on future studies of telomere protein genes and telomeric DNA in a multitude of eukaryotic cells. The hypothesis that a β-telomere protein does not exist in Euplotes crassus was supported by the result of this study.

Expression of the recombinant …

Evidence Of Natural Bluetongue Virus Infection Among African Carnivores, Kathleen A. Alexander, N. James Maclachlan, Pieter W. Kat, Carol House, Stephen J. O'Brien, Nicholas W. Lerche, Mary Sawyer, Laurence G. Frank, Kay Holekamp, Laura Smale, J. Weldon Mcnutt, M. Karen Laurenson, M. G. L. Mills, Bennie I. Osburn

Biology Faculty Articles

Bluetongue is an International Office of Epizootics List A disease described as the century's most economically devastating affliction of sheep. Bluetongue (BLU) viruses were thought to infect only ruminants, shrews, and some rodents, but recently, inadvertent administration of BLU virus-contaminated vaccine resulted in mortality and abortion among domestic dogs. We present evidence of natural BLU virus infection among African carnivores that dramatically widens the spectrum of susceptible hosts. We hypothesize that such infection occurred after ingestion of meat and organs from BLU virus infected prey species. The effect of BLU virus on endangered carnivores such as the cheetah and African …

Rock Lobster Industry Advisory Commitee Chairman's Report, October 1994 - The Western Rock Lobster Fishery - Management Proposals For The 1994/95 And 1995/96 Seasons, Rock Lobster Industry Advisory Committee, Peter Rogers

Fisheries Management Papers

The failures of past restrictions on fishing effort to fully halt the decline of the breeding stock led to the formation of a sub-committee of the Rock Lobster Industry Advisory Committee. The prime objective of the sub-committee is to evaluate effective long term strategies for managing the fishery so that breeding stock is maintained at an adequate level despite the inevitable increases in catching efficiency. The purpose of this report is firstly to advise industry of the management proposals for the 1994/95 seasons and secondly to form a basis for industry consultation on management arrangements for the 1995/96 season.

Long Term Management Strategies For The Western Rock Lobster Fishery (4 Volumes) - Law Enforcement Considerations (Volume 4), Neil Mclaughlan

Fisheries Management Papers

This report has been prepared for the consideration of the RLIAC Sub Committee in consultation with members of the Sub Committee working group on law enforcement and with senior staff of the Operations Division of the Fisheries Department. It is focussed exclusively on law enforcement issues associated with the management options for the West Australian west coast rock lobster fishery which were under consideration by the Sub Committee at the time of report preparation and should be read in conjunction with Fisheries Management Paper No. 67 entitled "Evaluation of management options" which covers the broader industry management issues. This report …

Long Term Management Strategies For The Western Rock Lobster Fishery (4 Volumes) - A Market-Based Economic Assessment For The Western Rock Lobster Industry (May 1994) (Volume 3), Marec Pty Ltd

Fisheries Management Papers

In October 1992 a special Sub-Committee of the Rock Lobster Industry Advisory Committee was set up to consider and evaluate future management strategies for the rock lobster fishery. Pursuant to this the Director of Fisheries commissioned a marketing study that is the basis of this report. This study was commenced in early October 1993 and completed in May 1994. This study looked at the market implications of fishery's management strategies. In particular it assesses how the existing management structure limits the potential for the lobster industry to maximise the financial return, and in doing so provides an insight into the …

Long Term Management Strategies For The Western Rock Lobster Industry (4 Volumes) - Economic Efficiency Of Alternative Input And Output Based Management Systems In The Western Rock Lobster Fishery (Volume 2), Bob Lindner

Fisheries Management Papers

Since 1965, the Western Rock Lobster Fishery has been managed by what is essentially a license limitation scheme invoiving restricted entry for boats, and strict controls on the aggregate number of pots which can be used by the commercial fishing sector. By most measures, management of this fishery has been highly successful. Biological over-exploitation of the fish stock has been prevented, at least until recently. Notwithstanding these achievements, there is widespread concern that the future profitability, and even the viability of the industry is under threat unless the current management practices are reformed. Because of the complexity and intrinsic uncertainty …

Long Term Management Strategies For The Western Rock Lobster (4 Volumes) - Evaluation Of Management Options (Volume 1), B. K. Bowen, Rock Lobster Industry Advisory Committee

Fisheries Management Papers

This report has been written following approval by the Minister for Fisheries of a recommendation by the Rock LObster Industry Advisory Committee that a major evaluation of future management options for the western rock lobster fishery be undertaken. The report provides background information on the management strategies and principles of the fishery, its stock status, the use of input and output controls and the size of the fishing fleet. The report concludes with an examination of the effect of maintaining effort (input) controls and moving to a system of variable effort (TAE/ITEs) or moving to direct (output) controls on the …

Review Of: The Genetic Frontier: Ethics, Law, And Policy (Mark S. Frankel & Albert Teich Eds., American Association For The Advancement Of Science 1994), Suzanne A. Sprunger

RISK: Health, Safety & Environment (1990-2002)

Review of: The Genetic Frontier: Ethics, Law, and Policy (Mark S. Frankel & Albert Teich eds., American Association for the Advancement of Science 1994). Acknowledgments, appendix, contributors, figures, index, introduction, notes, references, tables. LC 93-37230, ISBN 0-87168-526-4. [260 pp. Paper $22.95. 1333 H St., NW, Washington DC 20005.]

Future Of Management Of Recreational Gill, Haul, And Cast Netting In Western Australia And Summary Of Submissions To The Netting Review, F. B. Prokop, L. M. Adams

Fisheries Management Papers

The results of a major review into recreational gill and haul netting in Western Australia were announced by the Minister for Fisheries, Hon. Monty House MLA on 24 December 1993. This document presents the findings of the recreational netting review and the process which resulted in the announced changed to management practices.

A Lion Lentivirus Related To Feline Immunodeficiency Virus: Epidemiologic And Phylogenetic Aspects, Eric W. Brown, Naoya Yuhki, Craig Packer, Stephen J. O'Brien

Biology Faculty Articles

Feline immunodeficiency virus (FIV) is a novel lentivirus that is genetically homologous and functionally analogous to the human AIDS viruses, human immunodeficiency virus types 1 and 2. FIV causes immunosuppression in domestic cats by destroying the CD4 T-lymphocyte subsets in infected hosts. A serological survey of over 400 free-ranging African and Asian lions (Panthera leo) for antibodies to FIV revealed endemic lentivirus prevalence with an incidence of seropositivity as high as 90%o. A lion lentivirus (FIV-Ple) was isolated by infection of lion lymphocytes in vitro. Seroconversion was documented in two Serengeti lions, and discordance of mother-cub serological status …

Phylogeny Of The Malarial Genus Plasmodium, Derived From Rrna Gene Sequences, Ananias A. Escalante, Francisco J. Ayala

Harold W. Manter Laboratory of Parasitology: Library Materials

Malaria is among mankind's worst scourges, affecting many millions of people, particularly in the tropics. Human malaria is caused by several species of Plasmodium, a parasitic protozoan. We analyze the small subunit rRNA gene sequences of 11 Plasmodium species, including three parasitic to humans, to infer their evolutionary relationships. Plasmodium falciparum, the most virulent of the human species, is closely related to Plasmodium reiehenowi, which is parasitic to chimpanzee. The estimated time of divergence of these two Plasmodium species is consistent with the time of divergence (6-10 million years ago) between the human and chimpanzee lineages. The …

Proceedings Of A Symposium On Sustaining Rangeland Ecosystems, W. Daniel Edge, Sally L. Olson-Edge

Aspen Bibliography

No abstract provided.

A Thyroid Hormone-Regulated Gene In Xenopus Laevis Encodes A Type Iii Iodothyronine 5-Deiodinase., Donald L. St Germain, Robert Schwartzman, Walburga Croteau, Akira Kanamori, Zhou Wang, Donald D. Brown, Valerie Galton

Dartmouth Scholarship

The type III iodothyronine 5-deiodinase metabolizes thyroxine and 3,5,3'-triiodothyronine to inactive metabolites by catalyzing the removal of iodine from the inner ring. The enzyme is expressed in a tissue-specific pattern during particular stages of development in amphibia, birds, and mammals. Recently, a PCR-based subtractive hybridization technique has been used to isolate cDNAs prepared from Xenopus laevis tadpole tail mRNA that represent genes upregulated by thyroid hormone during metamorphosis. Sequence analysis of one of these cDNAs (XL-15) revealed regions of homology to the mRNA encoding the rat type I (outer ring) 5'-deiodinase, including a conserved UGA codon that encodes selenocysteine in …

Circadian Clock Locus Frequency: Protein Encoded By A Single Open Reading Frame Defines Period Length And Temperature Compensation., Benjamin D. Aronson, Keith A. Johnson, Jay C. Dunlap

Dartmouth Scholarship

The frequency (frq) locus encodes a key component, a state variable, in a cellular oscillator generating circadian rhythmicity. Two transcripts have been mapped to this region, and data presented here are consistent with the existence of a third transcript. Analysis of cDNA clones and clock mutants from this region focuses attention on one transcript encoding a protein. FRQ, which is a central clock component: (i) mutations in all of the semidominant frq alleles are the result of single amino acid substitutions and map to the open reading frame (ORF) encoding FRQ; (ii) deletion of this ORF, or a frameshift mutation …

Type Specimens Of Birds In The Museum Of Natural Science, Louisiana State University, Steven W. Cardiff, J. V. Remsen, Jr.

Occasional Papers of the Museum of Natural Science, Louisiana State University

No abstract provided.

Phylogenetic Associations Of Human And Simian T-Cell Leukemia/Lymphotropic Virus Type I Strains: Evidence For Interspecies Transmission, Igor J. Koralnik, Enzo Boeri, W. Carl Saxinger, Anita Lo Monico, Jake Fullen, Antoine Gessain, Hong-Guang Guo, Robert C. Gallo, Phillip Markham, Vaniambadi Kalyanaraman, Vanessa Hirsch, Jonathan Allan, Krishna Murthy, Patricia Alford, Jill Pecon-Slattery, Stephen J. O'Brien, Genoveffa Ranchini

Biology Faculty Articles

Homologous env sequences from 17 human T-leukemia/lymphotropic virus type I (HTLV-I) strains from throughout the world and from 25 simian T-leukemia/lymphotropic virus type I (STLV-I) strains from 12 simian species in Asia and Africa were analyzed in a phylogenetic context as an approach to resolving the natural history of these related retroviruses. STLV-I exhibited greater overall sequence variation between strains (1 to 18% compared with 0 to 9% for HTLV-I), supporting the simian origin of the modern viruses in all species. Three HTLV-I phylogenetic clusters or clades (cosmopolitan, Zaire, and Melanesia) were resolved with phenetic, parsimony, and likelihood analytical procedures. …

Analysis Of Human Sperm Chromatin Integrity, Silvina M. Bocca

Theses and Dissertations in Biomedical Sciences

Determining potential maternal or paternal sources of abnormal chromosomal constitution gives opportunity for preconception genetic counseling. The most direct determination is achieved by analyzing the nuclear constitution of the gametes.

The present study evaluated the integrity of human spermatozoal nuclear material in the two condensation stages of chromatin and chromosomes. Original semen samples (ORI) and their swim-up fractions (SW, selected for motility) from men of known (donors) and unknown (patients) fertility were analyzed. The extent of chromatin condensation was assessed by light microscopy and flow cytometry during the time course of a chemically-induced decondensation reaction.

Motile spermatozoa were used to …

Phylogenetic Analysis Of Segment 10 From African Horsesickness Virus And Cognate Genes From Other Orbiviruses, Rafael O. De Sá, Marla Zellner, Marvin J. Grubman

Biology Faculty Publications

Utilizing the reverse transcriptase-polymerase chain reaction (RT-PCR) procedure, we have synthesized full-length copies of segment 10 from African horsesickness virus (AHSV) serotypes 1,4 and 8. The genes were cloned, sequenced and compared with the sequence of the cognate gene from AHSV serotypes 3 and 9. Sequences were analyzed to assess evolutionary relationships among serotypes using cladistics. Based on this analysis the data support a close relationship between serotypes 4 and 9 and between serotypes 1 and 8 and a closer relationship of serotype 3 to the 4 and 9 group.

Maximizing The Return From Genome Research: Introduction, Thomas G. Field Jr.

RISK: Health, Safety & Environment (1990-2002)

Professor Field introduces and explains the origins of the symposium.

Technology Transfer: A View From The Trenches, Harvey Drucker

RISK: Health, Safety & Environment (1990-2002)

Dr. Drucker, who has lab-wide responsibility for technology transfer at Argonne National Laboratory, argues that transferring rights in discoveries made through tax supported research to private entities can contribute to public welfare in many ways.

Biotechnology Process Patents: Is Special Legislation Needed?, Timothy P. Linkkila, Timothy E. Tracy

RISK: Health, Safety & Environment (1990-2002)

The authors review administrative and court decisions prompting proposed changes to the patent law. After reviewing pros and cons, they argue that, on balance, pending bills can easily cause more problems than they solve.