Genetics and Genomics Commons^™

Biotechnology : Exposing The Myths & Realities, Sue Sutherland, Alan Lymbery

Journal of the Department of Agriculture, Western Australia, Series 4

Biotechnology has become one of the buzz words of the 1990s. Sounds impressive but what's it all about? Sue Sutherland and Alan Lymbery unravel some of the jargon and explore its potential for Western Australian agriculture.

Breeding Sheep For Worm Resistance, John Karlsson, Johan Greeff, Julia Harris

Journal of the Department of Agriculture, Western Australia, Series 4

Sheep production os one of Western Australia's most important agricultural industries. However, it is faced with the serious threat of sheep worm populations becoming increasingly resistant to the available drenches.

Although it's not a 'quick fix' solution, part of the long term answer may be selection for sheep with greater resistance to worms.

Genetic Discrimination And Health Insurance: An Urgent Need For Reform, Kathy L. Hudson, Karen H. Rothenberg, Lori B. Andrews, Mary Jo Ellis Kahn, Francis S. Collins

Faculty Scholarship

No abstract provided.

Sex And Temperament In Modern Society: A Darwinian View Of The “Glass Ceiling” And The “Gender Gap” In Compensation, Kingsley R. Browne

Law Faculty Research Publications

No abstract provided.

Characterization Of A Mutant Strain Of Saccharomyces Cerevisiae With A Deletion Of The Rad27 Gene, A Structural Homolog Of The Rad2 Nucleotide Excision Repair Gene, Michael S. Reagan, Christopher Pittenger, Wolfram Siede, Errol C. Friedberg

Biology Faculty Publications

We have constructed a strain of Saccharomyces cerevisiae with a deletion of the YKL510 open reading frame, which was initially identified in chromosome XI as a homolog of the RAD2 nucleotide excision repair gene (A. Jacquier, P. Legrain, and B. Dujon, Yeast 8:121–132, 1992). The mutant strain exhibits increased sensitivity to UV light and to the alkylating agent methylmethane sulfonate but not to ionizing radiation. We have renamed the YKL510 open reading frame the RAD27 gene, in keeping with the accepted nomenclature for radiationsensitive yeast mutants. Epistasis analysis indicates that the gene is in the RAD6 group of genes, which …

Media Components Influence Viral Gene Expression Assays In Human Fetal Astrocyte Cultures, Micheline Mccarthy, Charles Wood, Larisa Fedoseyeva, Scott R. Whittemore

Nebraska Center for Virology: Faculty Publications

In vitro neurovirological studies of viral infectivity or viral gene expression may be confounded by the mulHple neural cell types and/or fibrob last contamination present in early passage cultures prepared from dissociated human central nervous system (eNS) tissue. We have developed highly enriched astrocyte cultures for neurovirological study by culturing in a serum-free defined medium, 816, supplemented with basic fibroblast growth factor (FGF-2). Subculture in this medium selects against fibroblast proliferation and favors sustained proliferation of a highly enriched glial fibrillary acidic protein (GFAP)-positive cell population. These astrocytes support productive replication of cytomegalovirus (CMV) and transient expression of transfected CMVand …

Southern Idaho's Forest Land Outside National Forests, 1991, David C. Chojnacky

Aspen Bibliography

No abstract provided.

Pulpwood Production In The Lake States, 1993, Ronald J. Piva

Aspen Bibliography

Pulpwood production in the Lake States increased from 8.8 million cords in 1992 to 9.4 million cords in 1993. Michigan, Minnesota, and Wisconsin pulpwood production is shown by county and species group.

Use Of Sulfometuron In Hybrid Popular Energy Plantations, Daniel A. Netzer

Aspen Bibliography

No abstract provided.

Biomass Of Food Available To Beavers On Five Minnesota Shrubs, Richard R. Buech, David J. Rugg

Aspen Bibliography

No abstract provided.

Does Junk Dna Regulate Gene Expression In Humans, M. A. Hulten, Michael W. Stacey, S. J. Armstrong

Bioelectrics Publications

No abstract provided.

The Development Of Scars For Identification Of Am Fungi, Jason Daniel Abbas

Dissertations and Theses @ UNI

We have developed a rapid method of identification using molecular techniques to detect and differentiate two isolates of arbuscular mycorrhizal (AM) fungi. Polymerase Chain Reaction (PCR) was used to produce DNA fragments unique to the genomes of Glomus mosseae and Gigaspora margarita through RAPD analysis. The banding patterns produced by the arbitrary 10 base primer (5' CTGCCGCCAC) resulted in isolate specific fragments which were cloned using the pCR II™ cloning vector (lnvitrogen) and subsequently sequenced. Sequence data of the fragments led to the design of specific primer pairs (5' CTGCCGCCACTGGAACATGATTTTG and 5' CTGCCGCCACCAGAAATCGAACCG for Gigaspora margarita , 5' CTGCCGCCACCCCTATTTTAATCTAGCand5'CTGCCGCCACTGTCGGAATA for …

Mapping The Transcriptional Start Site(S) Of The Cannabinoid Receptor Gene, Jordana Baden

MUSC Theses and Dissertations

The cannabinoid receptor gene has recently been cloned. Comparisons of cDNA clones with genomic DNA show that the gene consists of a coding region and at least two untranslated 5' exons (A and B). Two alternative transcripts, differing in their 5' untranslated sequence, have been found that code for identical receptors. Primer extension for transcript A reveal that its most 5' transcriptional start site corresponds to nucleotide -548. Additional transcripts initiated 3' of -548 may exist. Ribonuclease protection assay and primer extension for transcript B reveal that its most 5' transcriptional start site corresponds to nucleotide -406. It is possible …

Localisation Of The Gene For A Novel Form Of Charcot-Marie-Tooth Disease In An Isolated Population, Kaite Honeyman

Theses : Honours

Localising the gene for a previously undescribed autosomal recessive form of CMT involved the use of a relatively new approach to rapid genome screening based on the identification of segments which are inherited identical by descent (IBD) from common founding ancestors. It is most feasible for populations which have been founded relatively recently (say less than 25 generations) and which have remained relatively isolated either geographically or culturally. The method is not suitable for highly inbred populations, that is with first and second cousin matings, as many segments will be inherited by chance. It appears to be a suitable screening …

Molecular Cloning And Rare Cleavage Mapping Of Human 2p, 6q, 8q, 12q, And 18q Telomeres, Roberto A. Macina, Ken Morii, Xue-Lan Hu, Dimitri G. Negorev, Chrysanthe Spais, Lisa A. Ruthig, Harold C. Riethman

School of Medical Diagnostics & Translational Sciences Publications

Large terminal fragments of human chromosomes 2p, 6q, 8q, 12q, and 18q were cloned using yeast artificial chromosomes (YACs). RecA-assisted restriction endonuclease (RARE) cleavage analysis of genomic DNA samples from 11 unrelated individuals using YAC-derived probes confirmed the telomeric localizations of the half-YACs studied. The cloned Fragments provide telomeric closure of maps for the respective chromosome arms and will supply the reagents needed for analyzing and sequencing these distal subtelomeric regions.