Open Access. Powered by Scholars. Published by Universities.®

Digital Commons Network™

Open Access. Powered by Scholars. Published by Universities.®

University of Northern Iowa

Discipline
Keyword
Publication Year
Publication
Publication Type
File Type

Articles 3211 - 3240 of 7391

Full-Text Articles in Entire DC Network

Editorial Board & Iowa Academy Of Science Officers And Directors Jan 1995

Editorial Board & Iowa Academy Of Science Officers And Directors

Journal of the Iowa Academy of Science: JIAS

No abstract provided.


Back Cover Jan 1995

Back Cover

Journal of the Iowa Academy of Science: JIAS

No abstract provided.


Pollution Prevention Manual For Lithographic Printers, Sue Behrns, Kathleen Gordon, Lisa Hurban, Cathy Zeman Jan 1995

Pollution Prevention Manual For Lithographic Printers, Sue Behrns, Kathleen Gordon, Lisa Hurban, Cathy Zeman

Iowa Waste Reduction Center Book Gallery

No abstract provided.


Adolescent Sexuality: The Role Of Parents, School, And Counselor, Steven A. Montross Jan 1995

Adolescent Sexuality: The Role Of Parents, School, And Counselor, Steven A. Montross

Graduate Research Papers

The rate of teenage sexual involvement is at an all-time high. It is estimated that 11.6 million teenagers between the ages 13-19 have had sexual intercourse, resulting in over 800,000 teenage pregnancies each year. With statistics such as these, problems arise: sexually active teens are at risk for contracting diseases such as AIDS, teenage mothers may often drop out of school, and many teen mothers live in poverty (Christopher & Roosa, 1990). In addition, children learn facts about sex at younger ages than did their parents and grandparents. On the positive side, there is the increasing maternal effort to impart …


Subpopulation Heterogeneity And Statistical Unreliability In Forensic Dna Typing, Nick Craig Jan 1995

Subpopulation Heterogeneity And Statistical Unreliability In Forensic Dna Typing, Nick Craig

Presidential Scholars Theses (1990 – 2006)

This paper consists of an overview of the procedures and criticisms involved in current forensic DNA typing. The opening presents a brief introduction to the genetic characteristics of DNA, followed by a review of the typing procedure. The main emphasis of the paper is the criticisms of the current procedure. These criticisms include an attack on the independence assumption and its justification of the use of the multiplication rule in calculating test results. A number of experts have proposed that heterogeneity within ethnic subpopulations may significantly undermine the independence assumption and render invalid the use of the multiplication rule. Others …


Loss Of The Tumor Suppressor Genes P53 And Brca1 In Prophylactic Mastectomy Cancer Patients, Garrett Griffith Losh Jan 1995

Loss Of The Tumor Suppressor Genes P53 And Brca1 In Prophylactic Mastectomy Cancer Patients, Garrett Griffith Losh

Presidential Scholars Theses (1990 – 2006)

More importantly, this study has shown that prophylactic mastectomy surgery is a viable and worthwhile treatment to prevent breast cancer recurrence. It is hoped that this information will increase the knowledge of breast cancer. For the same reason, this paper has attempted to explain what cancer is while describing how the genetics of a person cause or contribute to its development. Most of all, it is hoped that this paper will emphasize the severity of this disease in the United States today and tomorrow .


Effect Of Light Intensity And Temperature On Light-Avoiding Leaf Movements In Two Phaseolus Species, Douglas Bielenberg Jan 1995

Effect Of Light Intensity And Temperature On Light-Avoiding Leaf Movements In Two Phaseolus Species, Douglas Bielenberg

Presidential Scholars Theses (1990 – 2006)

It was the purpose of this experiment to determine the relationship between the factors of pulvinus temperature and light intensity in their role as factors that affect paraheliotropism. We also examined the differences in these relationships in two species adapted to different environments. The two species used were: Phaseolus vulgaris (common bean), a high yielding species which is grown in mesic climates, and P. acutifolius (tepary bean), an arid land bean which tolerates high temperatures and drought.


Cerebral Vascular Accidents And Therapeutic Treatments, Allison L. Hartman Jan 1995

Cerebral Vascular Accidents And Therapeutic Treatments, Allison L. Hartman

Presidential Scholars Theses (1990 – 2006)

A cerebral vascular accident (CVA) is commonly referred to as a stroke. Stroke is the third leading cause of death and the number one cause of serious disability in the United States. Approximately 550,000 people suffer a stroke each year; 150,000 of these result in death. Each stroke is unique. After a stroke, some victims will suffer severe deficits and/or permanent disability for the remainder of their lives. Yet other victims may suffer only mild, temporary deficits and may recover completely. Currently over three million Americans are living with the effects of stroke . Most of these individuals have been …


Selected Papers Of The Academy Of Youth Leaders, Susan R. Edginton, Christopher Edginton, Wendy L. Walser Jan 1995

Selected Papers Of The Academy Of Youth Leaders, Susan R. Edginton, Christopher Edginton, Wendy L. Walser

Faculty Book Gallery

The provision of high quality, high impact services is the quest of all youth service organizations. Selected Papers of the Academy for Youth Leaders presents a series of presentations from the U.S. Army Youth Services 25th anniversary celebration conference--A Silver Salute: A Journey into Excellence--held at the University of Northern Iowa.

There are a number of national trends impacting youth today that reinforce the need for strong, well-managed youth services in our communities. For example, it has been reported that over 40% of a youth's day is discretionary or leisure time and much of this time is spent without adult …


Childhood Obesity, Denise Kay Volker Jan 1995

Childhood Obesity, Denise Kay Volker

Dissertations and Theses @ UNI

The contributing factors in childhood obesity include psychological, physical fitness, and social elements. Much previous literature has studied such variables in isolation or in limited combinations. There is a need for multivariate approaches to the research in childhood obesity. The research question in this study was to determine was there any relationship between the subjects self-esteem, psychological and health locus-of-control, nutritional knowledge, food choices, and physical fitness, that will significantly distinguish overweight and normal weight youth, as determined through the measures of the PiersHarris Children's Self Concept Scale (PHCSCS), the Nowick~Strickland Loc4s-of-Control scale (CNS-IE), the Multidimensional Health Locus-of-Control scale (MHLC), …


A Comparison Of Two Methods Of Body Composition Assessment In Prepubescent Males And Females, Kristine M. Feldmann Jan 1995

A Comparison Of Two Methods Of Body Composition Assessment In Prepubescent Males And Females, Kristine M. Feldmann

Dissertations and Theses @ UNI

The. purpose of this study was to compare two methods of body composition assessment in predicting body fat percentages of 6-8 year old males and females. The percentage of body fat predicted from the bioelectrical impedance method was compared with the percentage of body fat predicted from skinfold measurements. It was hypothesized that there would be no difference between the RJL System's BIA 101 Impedance Analyzer and skinfolds in determining body fat percentage. Subjects consisted of 38 females with a mean age of 7.27 + .802 years and 22 males with a mean age of 7.16 + .808 years. Statistical …


Radon Reduction, Improvement Of Indoor Air Quality, And Energy Savings Through An Original Solar Ventilation System, Heather E. Rhoads Jan 1995

Radon Reduction, Improvement Of Indoor Air Quality, And Energy Savings Through An Original Solar Ventilation System, Heather E. Rhoads

Dissertations and Theses @ UNI

This study evaluated the improvement of indoor air quality and energy savings achieved, by an original solar ventilation system installed at test sites exhibiting elevated radon levels. Conventional residential energy conservation measures that limit air exchange rates between the indoors and outdoors have been shown to increase concentrations of radioactive radon decay products as well as other indoor air contaminants. Growing concern about radon lung cancer risks, carbon monoxide poisoning, and the "sick building syndrome" have increased demand for improved indoor air quality. Due to added heating and cooling loads, ventilation generally incurs substantial installation and operational costs. All commercially …


Assessment Of Weight Control Strategies Between Athletes And Nonathletes, Linda K. Buehler Jan 1995

Assessment Of Weight Control Strategies Between Athletes And Nonathletes, Linda K. Buehler

Dissertations and Theses @ UNI

The purpose of the present study was to assess motivation factors from a cognitive/social learning model for choosing a particular dieting style based on athletic status. One hundred ten athletes and 119 nonathletes were asked to fill out a series of questionnaires which included: A demographics inventory, an experimental questionnaire containing eight dieting methods (5 pathogenic dieting methods and 3 nonpathogenic dieting methods), the Beck Anxiety Inventory, the Beck Depression Inventory, and the Bulimia Test. The significant findings were: (a) nonathletes smoked to lose weight more often than athletes and athletes exercised to lose weight more often than nonathletes; (b) …


The Development Of Scars For Identification Of Am Fungi, Jason Daniel Abbas Jan 1995

The Development Of Scars For Identification Of Am Fungi, Jason Daniel Abbas

Dissertations and Theses @ UNI

We have developed a rapid method of identification using molecular techniques to detect and differentiate two isolates of arbuscular mycorrhizal (AM) fungi. Polymerase Chain Reaction (PCR) was used to produce DNA fragments unique to the genomes of Glomus mosseae and Gigaspora margarita through RAPD analysis. The banding patterns produced by the arbitrary 10 base primer (5' CTGCCGCCAC) resulted in isolate specific fragments which were cloned using the pCR II™ cloning vector (lnvitrogen) and subsequently sequenced. Sequence data of the fragments led to the design of specific primer pairs (5' CTGCCGCCACTGGAACATGATTTTG and 5' CTGCCGCCACCAGAAATCGAACCG for Gigaspora margarita , 5' CTGCCGCCACCCCTATTTTAATCTAGCand5'CTGCCGCCACTGTCGGAATA for …


The Influence Of Creativity, Family And Teachers On The Attainment Of Eminence, Mary Lynn Espenmiller Jan 1995

The Influence Of Creativity, Family And Teachers On The Attainment Of Eminence, Mary Lynn Espenmiller

Graduate Research Papers

The influence of creativity, family and teachers on the attainment of eminence was examined in this review of literature. The early childhood and education of many eminent adults was investigated to find the effect of these three factors on their achievement. Recommendations from the findings include early identification and nurturing of creative talent with exposure to many adults early in a child's development.


The Social And Cultural Matrix Of Adolescent Substance Abuse, Donald R. Murra Jan 1995

The Social And Cultural Matrix Of Adolescent Substance Abuse, Donald R. Murra

Graduate Research Papers

No abstract provided.


Student Violence In The Schools, Juan J. Barthelemy Jan 1995

Student Violence In The Schools, Juan J. Barthelemy

Graduate Research Papers

Acts of student violence in the schools are increasing (Chance, 1990; Crosby, 1993; Rich, 1992; Urben, 1986), especially in the larger cities in the United States (Hellman & Beaton, 1986). These acts of violence include violence toward other students as well as toward the school personnel and property. In this paper I will discuss selected aspects of violence in the schools. More specifically, I discuss the prevalence of violence in the schools, school based interventions and implications for the practice of school psychologists.


The Role Of The Family And Adolescent Delinquency, Doris Kriener Weigel Jan 1995

The Role Of The Family And Adolescent Delinquency, Doris Kriener Weigel

Graduate Research Papers

No abstract provided.


A Review Of The Literature On Remarried Families: Three Key Structural Components Of The Remarried Family Phenomena, Jennifer A. Sheka Jan 1995

A Review Of The Literature On Remarried Families: Three Key Structural Components Of The Remarried Family Phenomena, Jennifer A. Sheka

Graduate Research Papers

It is estimated that 60% of all first marriages in the United States end in divorce (Pasley, Dollahite & Ihinger-Tallman, 1993). Worthington & Hong (1992) suggested that 75-80% of all divorced persons remarry, and that remarried families are the fastest growing type of family in the United States. One out of five marriages is a remarriage for one or both spouses (Ganong & Coleman, 1989). Visher and Visher (1982) identified a trend indicating that 45 % of families would be single-parent or remarried families by 1990. These statistics are important because they represent a significant number of the families within …


Nonfiction Book Leisure Reading Interests Of High School Juniors At Columbus High School, Waterloo, Iowa, Susan A. Witthoft Jan 1995

Nonfiction Book Leisure Reading Interests Of High School Juniors At Columbus High School, Waterloo, Iowa, Susan A. Witthoft

Graduate Research Papers

The purpose of this study was to determine the nonfiction leisure reading interests of one-hundred and thirty juniors at Columbus High School in Waterloo, Iowa. The results of the survey revealed that one-third of the students read in their free time. Thirty-four percent of those who reported reading in their leisure time, choose to read nonfiction books. Twenty-four percent of the subjects believed that the purpose of nonfiction books was a combination of completing schoolwork and satisfying personal curiosity. The students also reported that the areas of sports and biography or autobiography were the two subjects they most liked to …


Homeschooling: An Educational Alternative For Iowa's High Ability Students, Roberta J. Mccurdy Jan 1995

Homeschooling: An Educational Alternative For Iowa's High Ability Students, Roberta J. Mccurdy

Graduate Research Papers

The purpose of this study was to ascertain the impact of homeschooling as an educational option for high ability students, particularly in Iowa. Using a literature review and personal interviews, the writer sought to determine the reasons parents homeschool, advantages and disadvantages of this option, and its impact on education in Iowa. The literature and interviews showed that a major reason that parents of high ability students homeschooled their children was a belief that the public school could not adequately provide for and challenge high ability students. The reviewed literature indicated that two important advantages of homeschooling for high ability …


The Effects Of Methyl Tertiary Butyl Ether (Mtbe) On The Hexadecane Mineralization Potentials Of Microbial Consortia, Christopher Matthew Horan Jan 1995

The Effects Of Methyl Tertiary Butyl Ether (Mtbe) On The Hexadecane Mineralization Potentials Of Microbial Consortia, Christopher Matthew Horan

Dissertations and Theses @ UNI

The environmental fate and biological effects of the fuel oxygenate methyl tertiary butyl ether (MTBE) is of concern because, among other factors, it is highly soluble (4.8g/100g H2 0) in water. Therefore, ground and surface water contamination may occur through accidental spills and leaks from underground storage tanks. Little is known about the biodegradability and ecotoxicity of MTBE. Continuous culture technique was used to enrich for MTBE degrading consortium or single species of microorganisms. Radiorespirometry was used to confirm that continuous culture enrichments would metabolize MTBE to carbon dioxide. Radiorespirometry was also used to measure the effects of MTBE on …


Contribution Or Contradiction: Feminist Philosophy And Feminist Practice Through The Eyes Of Young Women Activists, Margaret Ann Fox Jan 1995

Contribution Or Contradiction: Feminist Philosophy And Feminist Practice Through The Eyes Of Young Women Activists, Margaret Ann Fox

Dissertations and Theses @ UNI

The purpose of my research was to identify how young women activists interpret the purpose of their work on a clinic defense project, defending abortion clinics during protests. Each young woman had expectations of her work as a feminist activist. When her experiences were similar to what she envisioned as the purpose of feminist activism, she felt a sense of empowerment because she felt she was contributing to the "cause." Examples of contributing experiences included clinic defense trainings, lobbying, opposition research, grassroots organizing, and the physical defense of abortion clinics. However, when her experiences did not match her definition of …


Code-Switching And Sentence Imitation By African-American Students, Aaron Richardson Jan 1995

Code-Switching And Sentence Imitation By African-American Students, Aaron Richardson

Dissertations and Theses @ UNI

he purpose of the present study was to identify the accuracy of sentence imitation and code-switching by the African-American child between the ages of 6 years O months and 7 years 2 months. Despite well documented descriptions of Black English (BE) phonology (Dillard, 1972; Labov, 1972; Wolfram & Fasold, 1974), little has been published about the emerging phonology of BE speaking children. Most descriptive studies of BE have focused on the adult system.

The present study investigated the following research questions, "Will African-American children in this study, when presented with the task of imitating BE and IE sentences, code-switch each …


Pre-Instructional Student Conceptions Of Natural Selection And Evolution And Their Relationship To Cognitive Level, Terence John Coleman Jan 1995

Pre-Instructional Student Conceptions Of Natural Selection And Evolution And Their Relationship To Cognitive Level, Terence John Coleman

Dissertations and Theses @ UNI

The purpose of this study was to determine if there was a correlation between cognitive level and misconceptions regarding the concepts of natural selection and evolution in twenty-eight ninth grade students prior to instruction in tenth grade biology. In addition, the study examined the nature of student misconceptions. There were three major questions which guided the study: (a) What knowledge do ninth grade students possess regarding the concepts of natural selection and evolution prior to instruction in tenth grade? (b) What are the specific misconceptions that ninth grade students possess regarding the concepts of natural selection and evolution? (c) To …


Fall Commencement [Program], December 17, 1994, University Of Northern Iowa Dec 1994

Fall Commencement [Program], December 17, 1994, University Of Northern Iowa

UNI Commencement Programs

The program of the commencement ceremonies, including a list of institutional leadership, a list of the departments by college, awards given at the ceremonies, and a list of undergraduate and graduate degree candidates.


Uni Schedule Of Classes, Fall 1994, University Of Northern Iowa Oct 1994

Uni Schedule Of Classes, Fall 1994, University Of Northern Iowa

UNI Schedule of Classes

A listing and schedule of the courses being taught as well as policies and procedures concerning attending classes at the University of Northern Iowa.


Pls Newsletter, V5n2, October 1994, University Of Northern Iowa. Malcolm Price Laboratory School Oct 1994

Pls Newsletter, V5n2, October 1994, University Of Northern Iowa. Malcolm Price Laboratory School

Malcolm Price Laboratory School Newsletter

Inside this issue:
-- Paul J. Hamadi Joins PLS Community
-- Important Notice
-- Field House Update
-- PLS Harassment Policy
-- New PLS Faculty
-- 101 Ways Parents Can Help Students Achieve
-- Carnival - Raffle - Merchant's Market
-- Concert Dates for Middle School and High School Groups
-- Conferences Middle and High School
-- Blood Drive Planned
-- Children's Book Swap
-- Communication
-- Fall Play
-- Middle School Student-Led Parent Conferences


A Profile Of Students Enrolled At The University Of Northern Iowa, Fall Semester 1994, University Of Northern Iowa Oct 1994

A Profile Of Students Enrolled At The University Of Northern Iowa, Fall Semester 1994, University Of Northern Iowa

Institutional Effectiveness & Planning Documents

Contents:

--- Section I: Total Student Enrollment For Fall Semester 1994
--- Section II: New Students Entering UNI Fall Semester 1994
--- Section III: Miscellaneous


Earth News, Fall 1994, Department Of Earth Science, University Of Northern Iowa. Oct 1994

Earth News, Fall 1994, Department Of Earth Science, University Of Northern Iowa.

Earth News

Inside this issue:

--- Year in Review
--- Staff News
--- Earth Science Seminar Series Spring Semester, 1994
--- Earth Science Seminar Series Fall Semester, 1994
--- Graduating Seniors
--- Earth Science Department to Host W.I.M.P.S.
--- Sigma Gamma Epsilon
--- News from Alumni
--- Seasons Greetings from the Department of Earth Science