Open Access. Powered by Scholars. Published by Universities.®
- Institution
- Keyword
-
- Mitochondrial DNA (2)
- Alzheimer's disease (1)
- Amino acids (1)
- Cancer (1)
- Cell decondensation (1)
-
- Charcot-Marie-Tooth disease (1)
- Cx32 (1)
- Dehalogenases (1)
- Disease resistance (1)
- Epoxide hydrolases (1)
- Euchromatin (1)
- Gap junctions (1)
- Gene mapping (1)
- Genetic discrimination (1)
- Genetic improvement (1)
- Genetic testing (1)
- Genetic variation (1)
- Helminths (1)
- Heterochromatin instability (1)
- Incisures (1)
- Junk DNA (1)
- Katanning (1)
- Linkage (Genetics) (1)
- MCMV genes (1)
- Mutants (1)
- Mycorrihizas--Identification; Soil fungi--Identification; (1)
- Myelin (1)
- Neurodegenerative (1)
- Oligodendrocytes (1)
- Oncogenes (1)
- Publication
-
- Fisheries management papers (12)
- Biology Faculty Publications (3)
- Dissertations, Theses, and Masters Projects (3)
- Theses and Dissertations in Biomedical Sciences (3)
- All Faculty Scholarship (1)
-
- Bioelectrics Publications (1)
- Biological Sciences Theses & Dissertations (1)
- Dartmouth Scholarship (1)
- Department of Psychology: Faculty Publications (1)
- Dissertations and Theses @ UNI (1)
- Faculty Scholarship (1)
- Jeffrey K. Beetham (1)
- Journal of the Department of Agriculture, Western Australia, Series 4 (1)
- Theses : Honours (1)
- Publication Type
Articles 1 - 30 of 31
Full-Text Articles in Life Sciences
A Review Of Ministerial Policy Guidelines For Rock Lobster Processing In Western Australia From The Working Group Appointed By The Minister For Fisheries And Chaired By Peter Rich, Peter Rich
Fisheries management papers
The rock lobster processing industry in Western Australia has a long history of management. Whilst management of the industry through the Fisheries Department has obviously been successful in helping to build the rock lobster industry into one of the State's major export industries, this approach is not without problems. With the introduction of the Fisheries Management Act 1994, the Minister for Fisheries deemed it appropriate to appoint an expert group to review the existing regulation of the rock lobster processing sector, draft the necessary guidelines to assist the Executive Director of the Fisheries Department make decisions on rock lobster processing …
Connexin32 Is A Myelin-Related Protein In The Pns And Cns, Steven S. Scherer, Suzanne M. Deschênes, Yi-Tian Xu, Judith B. Grinspan, Kenneth H. Fischbeck, David L. Paul
Connexin32 Is A Myelin-Related Protein In The Pns And Cns, Steven S. Scherer, Suzanne M. Deschênes, Yi-Tian Xu, Judith B. Grinspan, Kenneth H. Fischbeck, David L. Paul
Biology Faculty Publications
We have examined the expression of a gap junction protein, connexin32 (Cx32), in Schwann cells and oligodendrocytes. In peripheral nerve, Cx32 is found in the paranodal myelin loops and Schmidt-Lanterman incisures of myelinating Schwann cells, and the levels of Cx32 protein and mRNA change in parallel with those of other myelin-related genes during development, Wallerian degeneration, and axonal regeneration. In the central nervous system, Cx32 is found in oligodendrocytes and their processes, but not in compact myelin, and the levels of Cx32 protein and mRNA increase during development in parallel with those of the other myelin genes. Thus, Cx32 is …
The Impact Of The New Management Package On Smaller Operators In The Western Rock Lobster Fishery, Ross Gould
The Impact Of The New Management Package On Smaller Operators In The Western Rock Lobster Fishery, Ross Gould
Fisheries management papers
For the 1993/94 western rock lobster fishing season several new management strategies were introduced. The objective of the changes to the management package was to protect the rock lobster fishery. It was also to provide sufficient breeding stock to ensure viability of the industry. The most significant new measure was a temporary (two seasons) 18 percent pot reduction. Other changes were also made. There were considered sound reasons for reviewing and changing the previous management package. Despite this, some fishermen were critical of the new management package, and claimed that it unfairly disadvantaged smaller operators. Against this background, the Department …
West Coast Rock Lobster Fishery Management Plan 1995 - Draft For Public Comment, M. Moran
West Coast Rock Lobster Fishery Management Plan 1995 - Draft For Public Comment, M. Moran
Fisheries management papers
The purpose of this management plan is to regulate fishing for rock lobsters (Family Palimuridae) in waters off the west coast of Western Australia such that the breeding stock of rock lobsters is maintained at a level known to have generated adequate recruitment of young lobsters in the past. This management plan does not constitute a change in the management arrangements for the rock lobster fishery. It essentially replaces the West Coast Rock Lobster Limited Entry Fishery Notice 1993 made under the Fisheries Act 1905 and makes the required changes to wording and structure necessitated by the proclamation of the …
Bag And Size Limit Fishing Regulations From Around Australia - Current Information As At 1 July, 1995 - Third Australasian Fisheries Managers Conference, Rottnest Island, Wa, F. B. Prokop
Fisheries management papers
This paper was originally prepared for the first National Fisheries Managers Conference in 1993. It is now updated and includes the current bag and size limits from around Australia as at 1 July, 1995. It is fairly obvious from this paper that there is a need for more cooperation between the states, particularly for species which have wide distributions. However, regional solutions can be a good approach for specific management needs, while general rules can be made more consistent in a number of cases.
Translocation Issues In Western Australia: Proceedings Of A Seminar And Workshop Held On 26th And 27th September 1994, F. B. Prokop
Translocation Issues In Western Australia: Proceedings Of A Seminar And Workshop Held On 26th And 27th September 1994, F. B. Prokop
Fisheries management papers
The Recreational Fishing Advisory Committee (RFAC) approved holding this translocation seminar to air the translocation of fish for recreational enhancement in a public forum. This forum will identify issues including establishing common ground between the variety of interest groups which are represented. Contentious areas which require further investigation and consultation should become apparent, and assist the formulation of appropriate policies on translocation for Western Australia.
Identification And Characterization Of Mitochondrial Dna Variants In Alzheimer's Disease, Natasha Singh Hamblet
Identification And Characterization Of Mitochondrial Dna Variants In Alzheimer's Disease, Natasha Singh Hamblet
Theses and Dissertations in Biomedical Sciences
Alzheimer's Disease (AD) is a complex neurodegenerative disorder that affects a significant portion of the human population regardless of ethnicity or gender. A mitochondrial hypothesis of AD has been proposed based on a number of studies which establish altered oxidative phosphorylation (OXPHOS) and ATP synthesis in AD tissue. ATP demand is most prevalent in the brain; damage to OXPHOS could severely impair brain metabolism, thereby leading to a decline in cognitive function. Four out of five complexes in the OXPHOS pathway are partly encoded by mitochondrial DNA (mtDNA); thus, this may be a crucial site of lesions that alter brain …
Investigation Of The Substrate Recognition Characteristics And Kinetics Of Mammalian Mitochondrial Dna Topoisomerase I, Zeki Topcu
Theses and Dissertations in Biomedical Sciences
Topoisomerases are DNA-modifying enzymes found in prokaryotes, eukaryotes, viruses and organelles such as chloroplast and mitochondria. Information about these enzymes in eukaryotic systems is mostly limited to nuclear enzymes, although our laboratory has been characterizing the biochemical and biophysical properties of the mammalian mitochondrial topoisomerases. We have determined the polarity of the attachment of mitochondrial topoisomerase I to its substrate DNA. To study the substrate preference and kinetic parameters of mitochondrial topoisomerase I, selected regions of mammalian mitochondrial DNA (mtDNA) were inserted into pGEM plasmid vectors following a series of modification and optimization experiments of currently available methods for PCR-cloning. …
Management Of The Northern Demersal Scalefish Fishery, Jane Fowler
Management Of The Northern Demersal Scalefish Fishery, Jane Fowler
Fisheries management papers
In mid 1994, the Fisheries Department of Western Australia announced that it would prepare a discussion paper setting out options for future management of the demersal scalefish fishery off the Kimberley coast. This paper, which was to be the start of a wider consultative process, was also to include options for possible further development of the trap and line fisheries. This paper is only the first step in a process for developing formal long term management arrangements under the new fisheries legislation, the Fish Resources Management Act 1994. Its aim is to provide some background and to present some management …
Report On Future Management Options For The South West Trawl Limited Entry Fishery, South West Trawl Limited Entry Fishery Working Group
Report On Future Management Options For The South West Trawl Limited Entry Fishery, South West Trawl Limited Entry Fishery Working Group
Fisheries management papers
As a result of community concern regarding trawling, the current management rules for the South West Trawl Limited Entry Fishery were finalised in February 1989 and the final plan was gazetted in October of that year. However, there was public disquiet about this trawling, and as a result of this disquiet, a research program was initiated by the Fisheries Department with funding received from both the Commonwealth and State Governments. The scientific report, "The impact of trawling for saucer scallops and western king prawns on the benthic communities in coastal waters off south-western Australia" by L J B Laurenson, P …
Management Options (Discussion Paper) For The Shark Bay Snapper Limited Entry Fishery, Shark Bay Snapper Limited Entry Fishery Working Group, Doug Bathgate
Management Options (Discussion Paper) For The Shark Bay Snapper Limited Entry Fishery, Shark Bay Snapper Limited Entry Fishery Working Group, Doug Bathgate
Fisheries management papers
At the Annual Management Meeting of the Shark Bay Snapper Limited Entry Fishery held on 22 July 1994 industry put forward a proposal that supplementary and non-transferable quota that was "lost" to the fishery when a licence holding non-transferable quota was transferred should be retained by the Fisheries Department and leased back to licence holders on an annual basis. As a result of this proposal and the fact that the management arrangements for the fishery are extremely complex and in need of simplification, the Minster for Fisheries approved the establishment of a Working Group to examine the lease-back proposal and …
3 Genes Of The Map Kinase Cascade, Mek-2, Mpk-1/Sur-1 And Let-60 Ras, Are Required For Meiotic Cell-Cycle Progression In Caenorhabditis-Elegans, Diane L. Church, Kun Liang Guan, Eric J. Lambie
3 Genes Of The Map Kinase Cascade, Mek-2, Mpk-1/Sur-1 And Let-60 Ras, Are Required For Meiotic Cell-Cycle Progression In Caenorhabditis-Elegans, Diane L. Church, Kun Liang Guan, Eric J. Lambie
Dartmouth Scholarship
In the germline of Caenorhabditis elegans hermaphrodites, meiotic cell cycle progression occurs in spatially restricted regions. Immediately after leaving the distal mitotic region, germ cells enter meiosis and thereafter remain in the pachytene stage of first meiotic prophase for an extended period. At the dorsoventral gonadal flexure, germ cells exit pachytene and subsequently become arrested in diakinesis. We have found that exit from pachytene is dependent on the function of three members of the MAP kinase signaling cascade. One of these genes, mek-2, is a newly identified C. elegans MEK (MAP kinase kinase). The other two genes, mpk-1/sur-1 (MAP kinase) …
The Bag And Size Limit Review: New Regulations And Summary Of Submissions, F. B. Prokop, J M. Collins
The Bag And Size Limit Review: New Regulations And Summary Of Submissions, F. B. Prokop, J M. Collins
Fisheries management papers
Since the new bag and size limits were introduced in December 1991, there have been many suggestions for refinement and improvement of these regulations. This paper includes the summary of submissions to Fisheries Management Paper No 52 - Review of Bag and Size Limit Proposals for Western Australian Recreational Fishers and details new regulations which will come into force on 1 July 1995.
The Best Available Information - Its Implications For Recreational Fisheries Management, F. B. Prokop
The Best Available Information - Its Implications For Recreational Fisheries Management, F. B. Prokop
Fisheries management papers
Workshop at Second National Fisheries Managers Conference, Bribie Island, Queensland, October 18, 1994. Recreational fisheries management is one of the growth areas in Australian fisheries. The Australian Society for Fish Biology Workshop topic for its 1994 Conference was Recreational Fishing - What's the Catch. It was acknowledged at the ASFB conference that there were generally poor levels of information and for the lower value commercial and recreational fisheries there may be no way to gather definitive research data for the foreseeable future. However, in even the high profile fisheries, public perceptions, attitudes, and political will do not allow for the …
Pathogenicity Of Murine Cytomegalovirus Mutants, Victoria Jean Cavanaugh
Pathogenicity Of Murine Cytomegalovirus Mutants, Victoria Jean Cavanaugh
Theses and Dissertations in Biomedical Sciences
The purpose of this study was to identified nonessential murine cytomegalovirus (MCMV) genes involved in pathogenesis in vivo. Our approach to identifyjng these genes consisted of constructing MCMV mutants, and then analyzing these mutants in vitro and in vivo. Recombinant viruses (RV) expressing the β-glucuronidase marker gene were constructed by site-directed insertion and deletion mutagenesis of the MCMV Hind III-J and -I regions of the viral genome. Mutations were targeted to this region of the MCMV genome because the corresponding region of the human CMV genome is nonessential and is involved in down-regulating major histocompatibility complex (MHC) class I expression …
Identification And Characterization Of Genes Associated With V-Jun Induced Cell Transformation, Martin Toralballa Hadman
Identification And Characterization Of Genes Associated With V-Jun Induced Cell Transformation, Martin Toralballa Hadman
Biological Sciences Theses & Dissertations
The v-jun oncogene was initially identified as the causative agent for fibrosarcomas in chickens. Studies show that overexpression of v-Jun proteins transforms chicken embryo fibroblasts (CEF) in vitro, and forms tumors in chickens in vivo. The mechanisms for this are not clearly defined. Conceivably, overexpression of an unregulated transcription factor would cause cell transfonnation by illicit regulation of its target genes. In support of this, we show that in vivo v-Jun complexes exhibit differential binding to in vitro generated AP-1 and 'AP-1 like' target sequences, suggesting that the pattern of target gene expression is altered during cell transformation. …
Enhancer Trap Technique: A Novel Tool For Identification And Developmental Characterization Of Genes Of Drosophila, Amit Singh
Biology Faculty Publications
The classical technique of mutational screen for identification of genes controlling early development has now approached saturation. A new era in genetic identification and developmental characterization of genes in Drosophila has commenced with the advent of the enhancer trap technique. This technique involves mobilization of a P-lacZ vector to diverse chromosomal locations in the fruit fly genome to bring it under the regulation of developmentally expressed genes or their enhancer elements. The technique offers a strikingly elegant method of gaining entry into fruit fly genes.
Draft Report Of The South Coast Estuarine Fishery Working Group, South Coast Estuarine Fishery Workng Group
Draft Report Of The South Coast Estuarine Fishery Working Group, South Coast Estuarine Fishery Workng Group
Fisheries management papers
The South Coast Estuarine Working Group was established in 1991 at the request of commercial fishermen by the Minister of the day. This report outlines a draft management plan for the South Coast Estuarine fishery that was made available for public comment.
Analyzing Correlations Of Three Types In Selected Lines Of Drosophila Melanogaster That Have Evolved Stable Extreme Geotactic Performance, Scott F. Stoltenberg, Jerry Hirsch, Stewart H. Berlocher
Analyzing Correlations Of Three Types In Selected Lines Of Drosophila Melanogaster That Have Evolved Stable Extreme Geotactic Performance, Scott F. Stoltenberg, Jerry Hirsch, Stewart H. Berlocher
Department of Psychology: Faculty Publications
The behavior-genetic analysis of Drosophila melanogaster with geotactic performance as the phenotype is an ideal model system with which to investigate the complex relations between heredity and behavior. As part of a long-term, 38-year study, we report 4 experiments that identify and analyze trait correlations in the selected high- and low-geotaxis lines. We performed F2 correlational analyses and backcrosses to examine 3 types of correlations: (a) genotype-genotype (alcohol dehydrogenase [Adh]-amylase [Amy]), (b) genotype-phenotype (Adh and Amy-geotaxis), and (c) phenotype-phenotype (mate preference–geotaxis). Only the Adh-geotaxis correlation survived meiosis and reappeared in the F …
An Improved Method For Chemical Devitellinization Of X-Gal Stained Drosophila Embryos, Amit Singh, Madhuri Kango-Singh, P. Sinha
An Improved Method For Chemical Devitellinization Of X-Gal Stained Drosophila Embryos, Amit Singh, Madhuri Kango-Singh, P. Sinha
Biology Faculty Publications
In Drosophila developmental biological studies, X-gal staining is commonly employed to study the spatio-temporal expression of the lacZ reporter gene in the transformed flies or their embryos. Study of the lacZ pattern in embryos often suffers from the lack of an efficient and high yieldirrg technique for devitellinization of X-gal stained embryos. Devitellinization techniques employed during antibody staining, in situ hybridization or embryonic cuticular preparations generally do not give satisfactory results when used for similar purpose in X-gal stained embryos. This results in the flaky appearance of the blue stain. We present here an improved chemical devitellinization technique which gives …
Implications Of Native Title Legislation For Fisheries Management And The Fishing Industry In Western Australia, Patricia Summerfield
Implications Of Native Title Legislation For Fisheries Management And The Fishing Industry In Western Australia, Patricia Summerfield
Fisheries management papers
This paper seeks to examine the key issues of both State and Commonwealth native title legislation for the fishing industry and fisheries management in Western Australia. Considerations for Aboriginal involvement in the industry and long-standing as well as recent concessionary arrangements for traditional usage of fish resources are examined. Industry reactions and future plans to accommodate native title in a positive framework are explored.
Breeding Sheep For Worm Resistance, John Karlsson, Johan Greeff, Julia Harris
Breeding Sheep For Worm Resistance, John Karlsson, Johan Greeff, Julia Harris
Journal of the Department of Agriculture, Western Australia, Series 4
Sheep production os one of Western Australia's most important agricultural industries. However, it is faced with the serious threat of sheep worm populations becoming increasingly resistant to the available drenches.
Although it's not a 'quick fix' solution, part of the long term answer may be selection for sheep with greater resistance to worms.
Gene Evolution Of Epoxide Hydrolases And Recommended Nomenclature, Jeffrey K. Beetham, David Grant, Michael Arand, Joan Garbarino, Tomohiro Kiyosue, Franck Pinot, Franz Oesch, William R. Belknap, Kazuo Shinosaki, Bruce D. Hammock
Gene Evolution Of Epoxide Hydrolases And Recommended Nomenclature, Jeffrey K. Beetham, David Grant, Michael Arand, Joan Garbarino, Tomohiro Kiyosue, Franck Pinot, Franz Oesch, William R. Belknap, Kazuo Shinosaki, Bruce D. Hammock
Jeffrey K. Beetham
We have analyzed amino acid sequence relationships among soluble and microsomal epoxide hydrolases, haloacid dehalogenases, and a haloalkane dehalogenase. The amino-terminal residues (1-229) of mammalian soluble epoxide hydrolase are homologous to a haloacid dehalogenase. The carboxy-terminal residues (230-554) of mammalian soluble epoxide hydrolase are homologous to haloalkane dehalogenase, to plant soluble epoxide hydrolase, and to microsomal epoxide hydrolase. The shared identity between the haloacid and haloalkane dehalogenases does not indicate relatedness between these two types of dehalogenases. The amino-terminal and carboxy-terminal homologies of mammalian soluble epoxide hydrolase to. the respective dehalogenases suggests that this epoxide hydrolase, but not the soluble …
Genetic Discrimination And Health Insurance: An Urgent Need For Reform, Kathy L. Hudson, Karen H. Rothenberg, Lori B. Andrews, Mary Jo Ellis Kahn, Francis S. Collins
Genetic Discrimination And Health Insurance: An Urgent Need For Reform, Kathy L. Hudson, Karen H. Rothenberg, Lori B. Andrews, Mary Jo Ellis Kahn, Francis S. Collins
Faculty Scholarship
No abstract provided.
Genetic Relationships Among Geographically Isolated Populations Of Bluefish (Pomatamus Saltatrix), Catherine N. O'Neill
Genetic Relationships Among Geographically Isolated Populations Of Bluefish (Pomatamus Saltatrix), Catherine N. O'Neill
Dissertations, Theses, and Masters Projects
No abstract provided.
The Development Of Scars For Identification Of Am Fungi, Jason Daniel Abbas
The Development Of Scars For Identification Of Am Fungi, Jason Daniel Abbas
Dissertations and Theses @ UNI
We have developed a rapid method of identification using molecular techniques to detect and differentiate two isolates of arbuscular mycorrhizal (AM) fungi. Polymerase Chain Reaction (PCR) was used to produce DNA fragments unique to the genomes of Glomus mosseae and Gigaspora margarita through RAPD analysis. The banding patterns produced by the arbitrary 10 base primer (5' CTGCCGCCAC) resulted in isolate specific fragments which were cloned using the pCR II™ cloning vector (lnvitrogen) and subsequently sequenced. Sequence data of the fragments led to the design of specific primer pairs (5' CTGCCGCCACTGGAACATGATTTTG and 5' CTGCCGCCACCAGAAATCGAACCG for Gigaspora margarita , 5' CTGCCGCCACCCCTATTTTAATCTAGCand5'CTGCCGCCACTGTCGGAATA for …
Localisation Of The Gene For A Novel Form Of Charcot-Marie-Tooth Disease In An Isolated Population, Kaite Honeyman
Localisation Of The Gene For A Novel Form Of Charcot-Marie-Tooth Disease In An Isolated Population, Kaite Honeyman
Theses : Honours
Localising the gene for a previously undescribed autosomal recessive form of CMT involved the use of a relatively new approach to rapid genome screening based on the identification of segments which are inherited identical by descent (IBD) from common founding ancestors. It is most feasible for populations which have been founded relatively recently (say less than 25 generations) and which have remained relatively isolated either geographically or culturally. The method is not suitable for highly inbred populations, that is with first and second cousin matings, as many segments will be inherited by chance. It appears to be a suitable screening …
Does Junk Dna Regulate Gene Expression In Humans, M. A. Hulten, Michael W. Stacey, S. J. Armstrong
Does Junk Dna Regulate Gene Expression In Humans, M. A. Hulten, Michael W. Stacey, S. J. Armstrong
Bioelectrics Publications
No abstract provided.
The Genetic Tie, Dorothy E. Roberts
Determination Of The Natal Origin And Genetic Stock Composition Of A Juvenile Feeding Population Of The Loggerhead Turtle (Caretta Caretta) In Chesapeake Bay, Jeffrey Worner Norrgard
Determination Of The Natal Origin And Genetic Stock Composition Of A Juvenile Feeding Population Of The Loggerhead Turtle (Caretta Caretta) In Chesapeake Bay, Jeffrey Worner Norrgard
Dissertations, Theses, and Masters Projects
No abstract provided.