Open Access. Powered by Scholars. Published by Universities.®

Digital Commons Network

Open Access. Powered by Scholars. Published by Universities.®

PDF

Iowa State University

1997

Discipline
Keyword
Publication
Publication Type

Articles 1291 - 1320 of 1332

Full-Text Articles in Entire DC Network

A Bioctahedral Nbiv Cluster With Bridging Sulfides: [Nb2(Μ-S)2cl4(Thf)4], M. Yoon, V. Young, Gordon J. Miller Jan 1997

A Bioctahedral Nbiv Cluster With Bridging Sulfides: [Nb2(Μ-S)2cl4(Thf)4], M. Yoon, V. Young, Gordon J. Miller

Chemistry Publications

The title compound, tetrachloro-l~2Cl,2n2Cl-tetrakis - (tetrahydrofuran-O)- 1 n 20,2n 20-di-#-thioxo- 1:2naS-dinio - bium(IV)(Nb--Nb), [Nb2C14S2(CnHsO)4], was obtained by the reaction of NbC14(thO2 (thf is tetrahydrofuran) with S(SiMe3)2 (hexamethyldisilathiane) in tetrahydrofuran. The compound forms edge-sharing bioctahedral clusters with bridging sulfide ligands and terminal chloride and thf ligands. All thf ligands coordinate in the equatorial plane formed by the Nb--S--Nb---S cycle. Two independent half dimers are found in the asymmetric unit about independent inversion centers located at the midpoints of the Nb---Nb bonds. Distance ranges are: Nb---Nb 2.865(1)-2.869(1 ...


Avidin-Biotin Immunohistochemical Detection Of Mycoplasma Gallisepticum Antigens In Turkey Respiratory Tissues With Rabbit Polyclonal Primary Antibodies, Zaher Zaher Ahmad Khalil Jan 1997

Avidin-Biotin Immunohistochemical Detection Of Mycoplasma Gallisepticum Antigens In Turkey Respiratory Tissues With Rabbit Polyclonal Primary Antibodies, Zaher Zaher Ahmad Khalil

Retrospective Theses and Dissertations

http://www.worldcat.org/oclc/37716579


Avidin-Biotin Immunohistochemical Detection Of Mycoplasma Gallisepticum Antigens In Turkey Respiratory Tissues With Rabbit Polyclonal Primary Antibodies, Zaher Radi Jan 1997

Avidin-Biotin Immunohistochemical Detection Of Mycoplasma Gallisepticum Antigens In Turkey Respiratory Tissues With Rabbit Polyclonal Primary Antibodies, Zaher Radi

Retrospective Theses and Dissertations

No abstract provided.


Superovulatory Response In New Zealand White Rabbits Under Environmental Heat Stress, Henrique Henrique Jan 1997

Superovulatory Response In New Zealand White Rabbits Under Environmental Heat Stress, Henrique Henrique

Retrospective Theses and Dissertations

http://www.worldcat.org/oclc/37781479


Superovulatory Response In New Zealand White Rabbits Under Environmental Heat Stress, Henrique Henrique Jan 1997

Superovulatory Response In New Zealand White Rabbits Under Environmental Heat Stress, Henrique Henrique

Retrospective Theses and Dissertations

http://www.worldcat.org/oclc/37781479


Studies On The Etiology Of Stunting Syndrome In Turkey Poults , Akbar Ali Jan 1997

Studies On The Etiology Of Stunting Syndrome In Turkey Poults , Akbar Ali

Retrospective Theses and Dissertations

Stunting syndrome is an enteric disease of turkey poults with unknown etiology. The objective of present study was to determine the etiologic agent(s) of SS. It was hypothesized that the intestinal epithelial cells (IELs) are infected during the disease. IECs, isolated from SS infected poults at 4 days post inoculation (PI), when inoculated to day-old susceptible poults produced the disease on the basis of reduction in weight gain and intestinal maltase activity. Following lysis of IECs, the 0.2 and 0.1 [mu]m filtrates produced the disease. Fractions collected following density gradient ultracentrifugation (using accudenz) were infectious for ...


Pou Domain Genes And The Immunoglobulin Octamer Motif In Chickens , Lynn Marie Heltemes Jan 1997

Pou Domain Genes And The Immunoglobulin Octamer Motif In Chickens , Lynn Marie Heltemes

Retrospective Theses and Dissertations

This research was undertaken to test the hypothesis that multiple POU genes exist and that POU proteins are involved in transcriptional regulation in the chicken. The POU protein Oct-2 has been hypothesized to partially regulate immunoglobulin gene expression through its interaction with the octamer motif found in the promoter of immunoglobulin genes. Transcriptional regulation of immunoglobulin genes provides a model for tissue-specific gene expression in the immune system. In searching for a chicken Oct-2 homologue, two partial chicken POU domain genes were identified. A cDNA clone encoding the POU domain of Brn-3a was isolated and showed near identity to the ...


Usual Intake Distributions In Risk Assessment For Food Residues, Sarah M. Nusser, Alicia L. Carriquiry, Helen H. Jensen Jan 1997

Usual Intake Distributions In Risk Assessment For Food Residues, Sarah M. Nusser, Alicia L. Carriquiry, Helen H. Jensen

Statistics Conference Proceedings, Presentations and Posters

The development of policies and regulations to promote food safety depends critically on our ability to estimate human health risks associated with consumption of food contaminants. Reliable estimates of exposure to residues and associated health risks require detailed information on food intakes and food residue concentrations, and appropriate statistical methods for combining this information.


Registration Of Eight Selected Bs11 Maize Germplasm Populations, Kendall R. Lamkey, Arnel R. Hallauer Jan 1997

Registration Of Eight Selected Bs11 Maize Germplasm Populations, Kendall R. Lamkey, Arnel R. Hallauer

Agronomy Publications

Eight maize (Zea mays L.) populations were developed cooperatively by the USDA-ARS and the Iowa Agriculture and Home Economics Experiment Station. The populations were developed as part of a larger breeding methods study conducted in the BSll maize population. Hallauer et al. (2) released BSll(FR)C2 after two cycles of full-sib reciprocal recurrent selection using BS10 as the tester population. Population BS1 I, originally designated as Pidneer Two-ear Composite, was developed by W.L. Brown at Pioneer Hi-Bred International by crossing southern prolific germplasm with U.S. Corn Belt lines (2). The main objective of the breeding methods study ...


Immobile Water Content And Mass Exchange Coefficient Of A Field Soil, F.X.M. Casey, Robert Horton Jr., S. D. Logsdon, Dan Jaynes Jan 1997

Immobile Water Content And Mass Exchange Coefficient Of A Field Soil, F.X.M. Casey, Robert Horton Jr., S. D. Logsdon, Dan Jaynes

Agronomy Publications

Determining the preferential flow characteristics of a soil is important because agrichemicals can contaminate groundwater via preferential flow pathways. A model that predicts solute transport due to preferential flow is the mobile-immobile solute transport model, which partitions the total water content (θ, m3 m−3) into a mobile fraction (θm) and an immobile fraction (θim). Recently, an in situ method was proposed for determining the mobile-immobile model parameters of θim and mass exchange coefficient (α) between the fractions by using a tension infiltrometer to apply a series of four fluorobenzoate tracers. The objective of this study ...


Ridge, Moldboard, Chisel, And No-Till Effects On Tile Water Quality Beneath Two Cropping Systems, Ramesh S. Kanwar, Thomas S. Colvin, Douglas L. Karlen Jan 1997

Ridge, Moldboard, Chisel, And No-Till Effects On Tile Water Quality Beneath Two Cropping Systems, Ramesh S. Kanwar, Thomas S. Colvin, Douglas L. Karlen

Agricultural and Biosystems Engineering Publications

Soil conservation tillage systems, including ridge-tillage, often reduce surface water contamination by pesticides because soil erosion and surface runoff are reduced. However, the effects on losses through subsurface drainage tile are somewhat uncertain. Our field study quantified the effects of four tillage practices in continuous corn (Zea mays L.) and corn-soybean [Glycine max (L.) Merr] rotations on herbicide and nitrate N losses in tile drainage water. Fertilizer and pesticide application methods were uniform for ridge, moldboard, chisel, and no-till systems. Pesticide and nitrate N leaching losses were significantly affected by crop rotation. Tillage practice had little influence on nitrate N ...


Employee Morale In The U.S. Class I Railroad Industry, Paula C. Morrow, Michael C. Crum, Frank J. Dooley Jan 1997

Employee Morale In The U.S. Class I Railroad Industry, Paula C. Morrow, Michael C. Crum, Frank J. Dooley

Management Publications

The U.S. railroad industry has experienced a dramatic turnaround since economic regulatory reform was legislated with the Staggers Rail Act of 1980. Increased competitive pressures and reduced regulation of ratemaking, routing, and network restructuring have lead to significant improvements in operating efficiency, service quality, and financial performance.


Human Rights Violations, Umbrella Concepts, And Empirical Analysis, James M. Mccormick, Neil J. Mitchell Jan 1997

Human Rights Violations, Umbrella Concepts, And Empirical Analysis, James M. Mccormick, Neil J. Mitchell

Political Science Publications

Only in last decade or two have political scientists begun sys tematic, cross-national research on government violations of human rights. The primary research focus has been the rights associ ated with the "integrity of the person." At least two factors account for this relatively recent attention: the interest of President Jimmy Carter and Congress in setting human rights as a goal of American foreign policy and the publication of country-by-country accounts of human rights performance by the U.S. Department of State, Amnesty Inter national, and Freedom House. As the issue rose on the political agenda and as data sources ...


A System Of Reaction Diffusion Equations Arising In The Theory Of Reinforced Random Walks, Howard A. Levine, Brian D. Sleeman Jan 1997

A System Of Reaction Diffusion Equations Arising In The Theory Of Reinforced Random Walks, Howard A. Levine, Brian D. Sleeman

Mathematics Publications

We investigate the properties of solutions of a system of chemotaxis equations arising in the theory of reinforced random walks. We show that under some circumstances, finite-time blow-up of solutions is possible. In other circumstances, the solutions will decay to a spatially constant solution (collapse). We also give some intuitive arguments which demonstrate the possibility of the existence of aggregation (piecewise constant) solutions.


Roundup™ Pre-Emergence Treatment To Determine The Presence Of The Roundup Ready™ Gene In Soybean Seed: A Laboratory Test, A. S. Goggi, M. G. Stahr Jan 1997

Roundup™ Pre-Emergence Treatment To Determine The Presence Of The Roundup Ready™ Gene In Soybean Seed: A Laboratory Test, A. S. Goggi, M. G. Stahr

Agronomy Publications

A laboratory test for determining the presence of the Roundup Ready™ gene in soybean seeds was developed by the ISU Seed Testing Laboratory and approved by Monsanto. The procedure recommended to evaluate the percent expression of the Roundup Ready™ gene includes a seed lot of unknown tolerance and two controls, a susceptible soybean seed lot and a known Roundup Ready™ soybean seed lot. All seed lots are imbibed in a 2% solution of the ROUNDUP™ ULTRA formulation (41% active ingredient), for a concentration of 0.82% active ingredient, glyphosate, in the solution. Two replications of 100 seeds of each lot ...


Rapid Communication: A Restriction Fragment Length Polymorphism In The Porcine Leptin Receptor (Lepr) Gene, Amy L. Vincent, L. Wang, Max F. Rothschild Jan 1997

Rapid Communication: A Restriction Fragment Length Polymorphism In The Porcine Leptin Receptor (Lepr) Gene, Amy L. Vincent, L. Wang, Max F. Rothschild

Animal Science Publications

Polymorphism. A HinfI PCR-RFLP was identified in the porcine leptin receptor ( LEPR) gene. Source and Description of Primers. Human cDNA (Gen- Bank accession no. U43168) sequence was used to design primers to amplify porcine genomic DNA. Primer Sequences. Forward primer: 5¢-GCATCCCATATCTGAACCC- 3¢; reverse primer: 5¢-CCACTTAAACCATAGCGAATC- 3¢.


A Probabilistic View Of Problems In Form Error Estimation, Tai-Hung Yang, John K. Jackman Jan 1997

A Probabilistic View Of Problems In Form Error Estimation, Tai-Hung Yang, John K. Jackman

Industrial and Manufacturing Systems Engineering Publications

Form error estimation techniques based on discrete point measurements can lead to significant errors in form tolerance evaluation. By modeling surface profiles as random variables, we show how sample size and fitting techniques affect form error estimation. Depending on the surface characteristics, typical sampling techniques can result in estimation errors of as much as 50 percent. Another issue raised in the fitting approach is the metric p selection for the fitting objective. We show that for p = 2 and p = ∞, the selection does not appear to significantly affect the estimation of form errors


Weed Seed Bank Emergence Across The Corn Belt, Frank Forcella, Robert G. Wilson, Robert J. Kremer, John Cardina, Randy L. Anderson, David Alm, Karen A. Renner, Robert G. Harvey, Sharon Clay, Douglas D. Buhler Jan 1997

Weed Seed Bank Emergence Across The Corn Belt, Frank Forcella, Robert G. Wilson, Robert J. Kremer, John Cardina, Randy L. Anderson, David Alm, Karen A. Renner, Robert G. Harvey, Sharon Clay, Douglas D. Buhler

Agronomy Publications

Field experiments, conducted from 1991 to 1994, generated information on weed seedbank emergence for 22 site-years from Ohio to Colorado and Minnesota to Missouri. Early spring seedbank densities were estimated through direct extraction of viable seeds from soil cores. Emerged seedlings were recorded periodically, as were daily values for air and soil temperature, and precipitation. Percentages of weed seedbanks that emerged as seedlings were calculated from seedbank and seedling data for each species, and relationships between seedbank emergence and microclimatic variables were sought. Fifteen species were found in 3 or more site-years. Average emergence percentages (and coefficients of variation) of ...


Registration Of Five Inbred Lines Of Maize: B102, B103, B104, B105, And B106, Arnel R. Hallauer, Kendall R. Lamkey, Paul R. White Jan 1997

Registration Of Five Inbred Lines Of Maize: B102, B103, B104, B105, And B106, Arnel R. Hallauer, Kendall R. Lamkey, Paul R. White

Agronomy Publications

Inbreds B102 (Reg. no. PL-281, PI 594045), B103 (Reg. no. PL- 282, PI 594046), B104 (Reg. no. PL-283, PI 594047), BIOS (Reg. no. PL-284, PI 594048), and B106 (Reg. no. PL-285, PI 594049) are yellow dent maize (Zea mays L.) lines developed cooperatively by the Iowa Agriculture and Home Economics Experiment Station and USDA-ARS. The lines were released on 8 Apr. 1996 because of their potential value as sources of germplasm in pedigreeselection breeding programs.


Dedication: Arnel R. Hallauer, Scientist, Maize Breeder, Quantitative Geneticist, Kendall R. Lamkey Jan 1997

Dedication: Arnel R. Hallauer, Scientist, Maize Breeder, Quantitative Geneticist, Kendall R. Lamkey

Agronomy Publications

Arnel R. Hallauer has dedicated his life to breeding; therefore, it is appropriate that this issue of Plant Breeding Reviews be dedicated to him. Dr. Hallauer's primary contributions have been in understanding quantitative inheritance in maize, developing breeding methodology, evaluating and utilizing recurrent selection for population improvement, and developing inbred lines for use in maize hybrids. Dr. Hallauer has also been very involved in graduate student education. The success of is students in academia and industry is a measure of his ability as a graduate educator and represents one of his greatest contributions to plant breeding. He has also ...


Testing A Nitrogen Fertilizer Applicator Designed To Reduce Leaching Losses, D. E. Ressler, R. Horton, J. L. Baker, T. C. Kaspar Jan 1997

Testing A Nitrogen Fertilizer Applicator Designed To Reduce Leaching Losses, D. E. Ressler, R. Horton, J. L. Baker, T. C. Kaspar

Agronomy Publications

Conventional practices for nitrogen fertilization of corn produce soil conditions that are conducive to preferential water flow and nitrate leaching. A new fertilizer applicator is proposed that will more effectively protect the fertilizer from infiltrating water and thus reduce the potential for leaching. The device forms a small compacted layer of soil above the subsurface fertilizer band and then mounds soil into a surface dome directly above the fertilizer band. This new localized compaction and doming (LCD) method is evaluated by measuring soil physical properties around the fertilizer band and comparing them with measurements made within the conventional knifing system ...


Alkoxido, Amido, And Imido Derivatives Of Titanium(Iv) Tetratolylporphyrin, Steven D. Gray, Joseph Lyndon Thorman, Lisa Mary Berreau, L. Keith Woo Jan 1997

Alkoxido, Amido, And Imido Derivatives Of Titanium(Iv) Tetratolylporphyrin, Steven D. Gray, Joseph Lyndon Thorman, Lisa Mary Berreau, L. Keith Woo

Chemistry Publications

Treatment of (TTP)TiCl2 (1) [TTP = meso-5,10,15,20-tetra-p-tolylporphyrinato dianion] with excess NaOR (R = Ph, Me, t-Bu) affords the bis(alkoxide) derivatives (TTP)Ti(OR)2 [R = Ph (2), Me (3), t-Bu (4)] in moderate yield. The corresponding amido derivative (TTP)Ti(NPh2)2(5) is prepared in an analogous fashion employing LiNPh2. The disubstituted complexes 2, 3, and 5 react cleanly with (TTP)TiCl2 to afford the ligand exchange products (TTP)Ti(OR)Cl [R = Ph (6), Me (7)] and (TTP)Ti(NPh2)Cl (8), respectively. The monosubstituted complexes 68are also ...


Rapid Communication: A Restriction Fragment Length Polymorphism In The Ovine Prolactin Gene, Amy L. Vincent, Max F. Rothschild Jan 1997

Rapid Communication: A Restriction Fragment Length Polymorphism In The Ovine Prolactin Gene, Amy L. Vincent, Max F. Rothschild

Animal Science Publications

Polymorphism. A HaeIII PCR-RFLP was identified in the ovine prolactin ( PRL) gene. Source and Description of Primers. Human genomic (Truong et al., 1984) and pig cDNA (GenBank accession no. X14068) sequences were compared to design primers to span the second intron of the prolactin gene.


Rapid Communication: A Novel Dna Polymorphism Of The Porcine Myogenin (Myog) Gene, E. A. Mendez, Catherine W. Ernst, Max F. Rothschild Jan 1997

Rapid Communication: A Novel Dna Polymorphism Of The Porcine Myogenin (Myog) Gene, E. A. Mendez, Catherine W. Ernst, Max F. Rothschild

Animal Science Publications

Source and Description of Primers. Primers were designed from published porcine myogenin (MYOG) sequence (GenBank accession number U14331) and were used to amplify a 1,644-bp fragment of the MYOG gene from porcine genomic DNA.


Rapid Communication: Mapping The Pig Vcam1 Locus To Chromosome 4 Using A Double-Stranded Conformation Polymorphism Marker (Vcam1-2), Christopher K. Tuggle, T. P. Yu, H. S. Sun, L. Wang, Max F. Rothschild Jan 1997

Rapid Communication: Mapping The Pig Vcam1 Locus To Chromosome 4 Using A Double-Stranded Conformation Polymorphism Marker (Vcam1-2), Christopher K. Tuggle, T. P. Yu, H. S. Sun, L. Wang, Max F. Rothschild

Animal Science Publications

Source and Description of Primers. We previously identified a SacI polymorphism by using a pig VCAM1 cDNA probe on Southern blots (VCAM1-1; Helm et al., 1994). This polymorphism was not informative enough to map VCAM1. To develop PCR-based genotyping, we sequenced the 3¢ untranslated region of pig VCAM1. Subsequently, a pig VCAM1 cDNA was deposited in Genbank; our data agree completely with that reported by Tsang et al. (Accession: U08351). The PCR primers were designed (forward, 5¢-TATCAGCCCTCCATAGTCACAT 3¢ and reverse, 5¢- GAAATTGTTGTCCATGACCTTTAT 3¢) .


Effect Of The Estrogen Receptor Locus On Reproduction And Production Traits In Four Commercial Pig Lines, T. H. Short, Max F. Rothschild, O. I. Southwood, D. G. Mclaren, A. De Vries, H. Van Der Steen, G. R. Eckardt, Christopher K. Tuggle, J. Helm, D. A. Vaske, A. J. Mileham, G. S. Plastow Jan 1997

Effect Of The Estrogen Receptor Locus On Reproduction And Production Traits In Four Commercial Pig Lines, T. H. Short, Max F. Rothschild, O. I. Southwood, D. G. Mclaren, A. De Vries, H. Van Der Steen, G. R. Eckardt, Christopher K. Tuggle, J. Helm, D. A. Vaske, A. J. Mileham, G. S. Plastow

Animal Science Publications

We investigated the effect of the estrogen receptor (ESR) gene on growth and reproductive traits in four Large White-based commercial pig lines. A total of 9,015 litter records from 4,262 sows genotyped at the ESR locus were analyzed to determine whether ESR influenced total number born (TNB) or number born alive (NBA). Teat number (TN), test ADG, ADFI, feed:gain ratio (F/G), and ultrasonic backfat (BF) were also analyzed to determine effects of ESR. The TNB and NBA were increased per favorable allele of ESR (P < .01) with additive effects of .42 (.31) and .39 (.31) pigs/litter in the first parity (later parities), respectively. Dominance effects were near zero in parity one, but they were .16 and .14 pigs for TNB and NBA, respectively, in later parities (P < .05). A favorable additive pleiotropic effect was detected for BF (P < .001; -.11 mm per copy of the favorable litter size allele). There were no detectable effects on ADG or F/G (P > .10), although ADF was reduced 18 g/d per copy of ...


Maternal Performance Differences Between Porcine Stress Syndrome-Normal And -Carrier Landrace Females, Kenneth J. Stalder, L. L. Christian, Max F. Rothschild, E. C. Lin Jan 1997

Maternal Performance Differences Between Porcine Stress Syndrome-Normal And -Carrier Landrace Females, Kenneth J. Stalder, L. L. Christian, Max F. Rothschild, E. C. Lin

Animal Science Publications

Differences between porcine stress syndrome (PSS) normal (NN) and carrier (Nn) Landrace dams were determined for adjusted number of pigs born alive, adjusted number of pigs at 21 d, adjusted 21-d litter weight, proportion of pigs surviving to 21 d, and farrowing interval. Data were analyzed from a total of 841 females, 623 normal (NN) and 218 carriers (Nn) having 2,231 and 869 records, respectively. Three susceptible (nn) females from two herds were dropped from the analysis because of their small contribution to the total number of records. Frequency of the recessive PSS allele ranged from .07 to .28 ...


Physical And Rheological Properties Of Slaughterhouse Swine Blood And Blood Components, Kurt A. Rosentrater, Rolando A. Flores Jan 1997

Physical And Rheological Properties Of Slaughterhouse Swine Blood And Blood Components, Kurt A. Rosentrater, Rolando A. Flores

Agricultural and Biosystems Engineering Publications

Blood, a valuable by-product of livestock slaughter, has numerous food, industrial, and pharmaceutical uses. Physical and rheological properties, including apparent viscosity, density, surface tension, thermal conductivity, and specific heat, are needed for the design of transport processes and by-product applications such as spray drying, blending, and extrusion. Information about these properties for slaughter by-products, however, is not currently available. Consequently, the objective of this study was to determine these properties for anticoagulated swine blood, blood plasma, and red blood cells between 5 and 35°C. The plasma in this study was enriched with hemoglobin from the red cells as a ...


Energetics Of Segregated Early Weaned Pigs, Jay D. Harmon, Hongwei Xin, Junging Shao Jan 1997

Energetics Of Segregated Early Weaned Pigs, Jay D. Harmon, Hongwei Xin, Junging Shao

Agricultural and Biosystems Engineering Publications

The energetics of early weaned (13 to 16 days old) pigs were examined under four temperature regimes. The pigs, in groups of 10 (0.28 m2/pig), were housed in the indirect calorimeter chambers at initial air temperatures of 31.1, 28.9, 26.7, or 24.4°C which then were decreased by 1.1°C per week for the three weeks of the post-weaning period. The feed efficiency and average daily gain during the three-week trial for the four temperature regimes were 1.30, 360 g/day; 1.33, 380 g/day; 1.38, 370 g/day; and ...


Evaluation Of Tractor And Grain Wagon Safety Marking At Selected Commercial Iowa Grain Elevators, H. Mark Hanna, Charles V. Schwab, Carol J. Lehtola, Richard W. Steffen Jan 1997

Evaluation Of Tractor And Grain Wagon Safety Marking At Selected Commercial Iowa Grain Elevators, H. Mark Hanna, Charles V. Schwab, Carol J. Lehtola, Richard W. Steffen

Agricultural and Biosystems Engineering Publications

The three categories of agents involved in the largest number of agricultural fatalities in Iowa are tractors, other farm machinery, and motor vehicles. All are involved during harvest as grain is transported on public roadways. Forty-eight percent of all motor vehicle collisions involving farm equipment in Iowa occur from October through December. Tractors and wagons delivering grain to six elevators during fall harvest were evaluated. Vocational agriculture student teams inspected for compliance with Iowa code and ASAE standards for lighting, marking, hitch, and ROPS safety equipment.

A majority of tractors complied with safety standards for: headlights, front amber flashing lights ...