Open Access. Powered by Scholars. Published by Universities.®

Digital Commons Network

Open Access. Powered by Scholars. Published by Universities.®

Articles 1 - 7 of 7

Full-Text Articles in Entire DC Network

Functional Characterization Of A Chicken Major Histocompatibility Complex Class Ii B Gene Promoter, Yunfei Chen, Hyun S. Lillehoj, Chung-Hsin Hsu, Susan L. Carpenter, Susan J. Lamont Jan 1997

Functional Characterization Of A Chicken Major Histocompatibility Complex Class Ii B Gene Promoter, Yunfei Chen, Hyun S. Lillehoj, Chung-Hsin Hsu, Susan L. Carpenter, Susan J. Lamont

Animal Science Publications

A 0.7 kilobase (kb) DNA fragment from the 5' flanking region of a chicken major histocompatibility complex (MHC) class II B gene was cloned into chloramphenicol acetyltransferase (CAT) reporter vectors and was transfected into a chicken macrophage cell line that expresses a low level of MHC class II antigens. Positive orientation-dependent promoter activity of the chicken DNA was evident in a reporter construct containing an SV40 enhancer. Deletion analysis of this 0.7 kb DNA fragment revealed a short fragment in the 3' end that was crucial for the promoter function and negative regulatory elements (NRE) located further upstream ...


Rapid Communication: Mapping The Pig Vcam1 Locus To Chromosome 4 Using A Double-Stranded Conformation Polymorphism Marker (Vcam1-2), Christopher K. Tuggle, T. P. Yu, H. S. Sun, L. Wang, Max F. Rothschild Jan 1997

Rapid Communication: Mapping The Pig Vcam1 Locus To Chromosome 4 Using A Double-Stranded Conformation Polymorphism Marker (Vcam1-2), Christopher K. Tuggle, T. P. Yu, H. S. Sun, L. Wang, Max F. Rothschild

Animal Science Publications

Source and Description of Primers. We previously identified a SacI polymorphism by using a pig VCAM1 cDNA probe on Southern blots (VCAM1-1; Helm et al., 1994). This polymorphism was not informative enough to map VCAM1. To develop PCR-based genotyping, we sequenced the 3¢ untranslated region of pig VCAM1. Subsequently, a pig VCAM1 cDNA was deposited in Genbank; our data agree completely with that reported by Tsang et al. (Accession: U08351). The PCR primers were designed (forward, 5¢-TATCAGCCCTCCATAGTCACAT 3¢ and reverse, 5¢- GAAATTGTTGTCCATGACCTTTAT 3¢) .


Effect Of The Estrogen Receptor Locus On Reproduction And Production Traits In Four Commercial Pig Lines, T. H. Short, Max F. Rothschild, O. I. Southwood, D. G. Mclaren, A. De Vries, H. Van Der Steen, G. R. Eckardt, Christopher K. Tuggle, J. Helm, D. A. Vaske, A. J. Mileham, G. S. Plastow Jan 1997

Effect Of The Estrogen Receptor Locus On Reproduction And Production Traits In Four Commercial Pig Lines, T. H. Short, Max F. Rothschild, O. I. Southwood, D. G. Mclaren, A. De Vries, H. Van Der Steen, G. R. Eckardt, Christopher K. Tuggle, J. Helm, D. A. Vaske, A. J. Mileham, G. S. Plastow

Animal Science Publications

We investigated the effect of the estrogen receptor (ESR) gene on growth and reproductive traits in four Large White-based commercial pig lines. A total of 9,015 litter records from 4,262 sows genotyped at the ESR locus were analyzed to determine whether ESR influenced total number born (TNB) or number born alive (NBA). Teat number (TN), test ADG, ADFI, feed:gain ratio (F/G), and ultrasonic backfat (BF) were also analyzed to determine effects of ESR. The TNB and NBA were increased per favorable allele of ESR (P < .01) with additive effects of .42 (.31) and .39 (.31) pigs/litter in the first parity (later parities), respectively. Dominance effects were near zero in parity one, but they were .16 and .14 pigs for TNB and NBA, respectively, in later parities (P < .05). A favorable additive pleiotropic effect was detected for BF (P < .001; -.11 mm per copy of the favorable litter size allele). There were no detectable effects on ADG or F/G (P > .10), although ADF was reduced 18 g/d per copy of ...


Rapid Communication: A Restriction Fragment Length Polymorphism In The Ovine Prolactin Gene, Amy L. Vincent, Max F. Rothschild Jan 1997

Rapid Communication: A Restriction Fragment Length Polymorphism In The Ovine Prolactin Gene, Amy L. Vincent, Max F. Rothschild

Animal Science Publications

Polymorphism. A HaeIII PCR-RFLP was identified in the ovine prolactin ( PRL) gene. Source and Description of Primers. Human genomic (Truong et al., 1984) and pig cDNA (GenBank accession no. X14068) sequences were compared to design primers to span the second intron of the prolactin gene.


Rapid Communication: A Novel Dna Polymorphism Of The Porcine Myogenin (Myog) Gene, E. A. Mendez, Catherine W. Ernst, Max F. Rothschild Jan 1997

Rapid Communication: A Novel Dna Polymorphism Of The Porcine Myogenin (Myog) Gene, E. A. Mendez, Catherine W. Ernst, Max F. Rothschild

Animal Science Publications

Source and Description of Primers. Primers were designed from published porcine myogenin (MYOG) sequence (GenBank accession number U14331) and were used to amplify a 1,644-bp fragment of the MYOG gene from porcine genomic DNA.


Rapid Communication: A Restriction Fragment Length Polymorphism In The Porcine Leptin Receptor (Lepr) Gene, Amy L. Vincent, L. Wang, Max F. Rothschild Jan 1997

Rapid Communication: A Restriction Fragment Length Polymorphism In The Porcine Leptin Receptor (Lepr) Gene, Amy L. Vincent, L. Wang, Max F. Rothschild

Animal Science Publications

Polymorphism. A HinfI PCR-RFLP was identified in the porcine leptin receptor ( LEPR) gene. Source and Description of Primers. Human cDNA (Gen- Bank accession no. U43168) sequence was used to design primers to amplify porcine genomic DNA. Primer Sequences. Forward primer: 5¢-GCATCCCATATCTGAACCC- 3¢; reverse primer: 5¢-CCACTTAAACCATAGCGAATC- 3¢.


Rapid Communication: Linkage Mapping Of Porcine Interleukin 6 (Il6), N. E. Burk, A. L. Vincent, Max F. Rothschild Jan 1997

Rapid Communication: Linkage Mapping Of Porcine Interleukin 6 (Il6), N. E. Burk, A. L. Vincent, Max F. Rothschild

Animal Science Publications

Source and Description of Primers. Dog primers designed from human sequence (Venta et al., 1996) were used to amplify a 774-bp fragment of the porcine IL6 gene. The 5¢ primer is located in exon 3, and the 3¢ primer is located in exon 4.